EMAIL THIS PAGE TO A FRIEND

KCNK13

potassium channel, subfamily K, member 13

68 Gene Product Result for
Synonyms: K2p13.1 THIK-1 THIK1
UniProtKB ID: Q9HB14, Q96E79
Gene ID:
Human(56659) Summary: Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a potassium channel containing two pore-forming domains. This protein is an open channel that can be stimulated by arachidonic acid and inhibited by the anesthetic halothane. [provided by RefSeq, Jul 2013]
Mouse(217826) potassium channel, subfamily K, member 13
Rat(64120) potassium channel, subfamily K, member 13
chicken(772210) potassium channel, subfamily K, member 13
dog(490829) potassium channel, subfamily K, member 13
domestic cat(101093780) potassium channel, subfamily K, member 13
cow(787307) potassium channel, subfamily K, member 13
Domestic Rabbit(100349028) potassium channel, subfamily K, member 13
domestic guinea pig(100724944) potassium channel, subfamily K, member 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146037 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146037 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146037 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022054 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010401 MISSION® esiRNA esiRNA targeting human KCNK13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022054 Rosetta Predictions human pricing
NM_022293 Rosetta Predictions rat pricing
XM_001072457 Rosetta Predictions rat pricing
NM_146037 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111198 predicted 1843
2 SASI_Hs01_00111199 predicted 1577
3 SASI_Hs01_00111200 predicted 1862
4 SASI_Hs01_00111201 predicted 1509
5 SASI_Hs01_00111202 predicted 1484
6 SASI_Hs01_00111203 predicted 1614
7 SASI_Hs01_00111204 predicted 1113
8 SASI_Hs01_00111205 predicted 1356
9 SASI_Hs01_00111206 predicted 1030
10 SASI_Hs01_00111207 predicted 1932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022293 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062204 predicted 1522
2 SASI_Rn01_00062205 predicted 1525
3 SASI_Rn01_00062206 predicted 757
4 SASI_Rn01_00062207 predicted 1688
5 SASI_Rn01_00062208 predicted 905
6 SASI_Rn01_00062209 predicted 1503
7 SASI_Rn01_00062210 predicted 1648
8 SASI_Rn01_00062211 predicted 488
9 SASI_Rn01_00062212 predicted 1723
10 SASI_Rn02_00263110 predicted 1456
11 SASI_Rn01_00062203 predicted 1496
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072457 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339248 predicted 1027
2 SASI_Rn02_00339249 predicted 1059
3 SASI_Rn02_00339250 predicted 1011
4 SASI_Rn02_00339251 predicted 1017
5 SASI_Rn02_00339252 predicted 1028
6 SASI_Rn02_00339253 predicted 988
7 SASI_Rn02_00339254 predicted 1057
8 SASI_Rn02_00339255 predicted 978
9 SASI_Rn02_00339256 predicted 1032
10 SASI_Rn02_00339257 predicted 1020
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146037 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181016 predicted 711
2 SASI_Mm01_00181018 predicted 438
3 SASI_Mm02_00341631 predicted 1271
4 SASI_Mm01_00181019 predicted 262
5 SASI_Mm02_00341632 predicted 346
6 SASI_Mm02_00341633 predicted 1519
7 SASI_Mm01_00181020 predicted 649
8 SASI_Mm01_00181022 predicted 809
9 SASI_Mm01_00181023 predicted 1317
10 SASI_Mm01_00181024 predicted 249
11 SASI_Mm01_00181015 predicted 461
12 SASI_Mm01_00181017 predicted 577
13 SASI_Mm01_00181021 predicted 635
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146037
KCNK13 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146037.1-382s1c1
Sequence:CCGGCCATAGGGTTTGGGATGACAACTCGAGTTGTCATCCCAAACCCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146037.1-722s1c1
Sequence:CCGGCTACTTTGACTCGGTCTACTTCTCGAGAAGTAGACCGAGTCAAAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146037.1-466s1c1
Sequence:CCGGCCATCCTCTTCTTCAACCTTTCTCGAGAAAGGTTGAAGAAGAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146037.1-1219s1c1
Sequence:CCGGGAGCCTTTGCAGTAATGAATACTCGAGTATTCATTACTGCAAAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146037.1-869s1c1
Sequence:CCGGCTACTCTTTGTTTAACGTCATCTCGAGATGACGTTAAACAAAGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146037
KCNK13 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146037.1-382s1c1
Sequence:CCGGCCATAGGGTTTGGGATGACAACTCGAGTTGTCATCCCAAACCCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146037.1-722s1c1
Sequence:CCGGCTACTTTGACTCGGTCTACTTCTCGAGAAGTAGACCGAGTCAAAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146037.1-466s1c1
Sequence:CCGGCCATCCTCTTCTTCAACCTTTCTCGAGAAAGGTTGAAGAAGAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146037.1-1219s1c1
Sequence:CCGGGAGCCTTTGCAGTAATGAATACTCGAGTATTCATTACTGCAAAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146037.1-869s1c1
Sequence:CCGGCTACTCTTTGTTTAACGTCATCTCGAGATGACGTTAAACAAAGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146037
KCNK13 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146037.1-382s1c1
Sequence:CCGGCCATAGGGTTTGGGATGACAACTCGAGTTGTCATCCCAAACCCTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146037.1-722s1c1
Sequence:CCGGCTACTTTGACTCGGTCTACTTCTCGAGAAGTAGACCGAGTCAAAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146037.1-466s1c1
Sequence:CCGGCCATCCTCTTCTTCAACCTTTCTCGAGAAAGGTTGAAGAAGAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146037.1-1219s1c1
Sequence:CCGGGAGCCTTTGCAGTAATGAATACTCGAGTATTCATTACTGCAAAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146037.1-869s1c1
Sequence:CCGGCTACTCTTTGTTTAACGTCATCTCGAGATGACGTTAAACAAAGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022054
KCNK13 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 13
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022054.2-1021s1c1
Sequence:CCGGCGTGTACTACGTCATGCTGATCTCGAGATCAGCATGACGTAGTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022054.2-889s1c1
Sequence:CCGGGATCACCATCATCGCCTACATCTCGAGATGTAGGCGATGATGGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022054.2-760s1c1
Sequence:CCGGCGTCGTTTCCACCATAGGGTTCTCGAGAACCCTATGGTGGAAACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022054.2-1477s1c1
Sequence:CCGGGATGATCTCCATGAAGGACTTCTCGAGAAGTCCTTCATGGAGATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022054.2-1285s1c1
Sequence:CCGGCCTCATCAAACAGTCCTTGAACTCGAGTTCAAGGACTGTTTGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022054.2-785s21c1
Sequence:CCGGATGACAACTCCGGCGACAGTACTCGAGTACTGTCGCCGGAGTTGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022054.2-1940s21c1
Sequence:CCGGCATTGCCTTGTTTCATTAATCCTCGAGGATTAATGAAACAAGGCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022054.2-1867s21c1
Sequence:CCGGGCTTGTCTCCTGATCCTTATTCTCGAGAATAAGGATCAGGAGACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022054.2-1700s21c1
Sequence:CCGGGAGTAGAATGGAGGATGATTGCTCGAGCAATCATCCTCCATTCTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022054
KCNK13 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 13
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022054.2-1021s1c1
Sequence:CCGGCGTGTACTACGTCATGCTGATCTCGAGATCAGCATGACGTAGTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022054.2-889s1c1
Sequence:CCGGGATCACCATCATCGCCTACATCTCGAGATGTAGGCGATGATGGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022054.2-760s1c1
Sequence:CCGGCGTCGTTTCCACCATAGGGTTCTCGAGAACCCTATGGTGGAAACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022054.2-1477s1c1
Sequence:CCGGGATGATCTCCATGAAGGACTTCTCGAGAAGTCCTTCATGGAGATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022054.2-1285s1c1
Sequence:CCGGCCTCATCAAACAGTCCTTGAACTCGAGTTCAAGGACTGTTTGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022054.2-785s21c1
Sequence:CCGGATGACAACTCCGGCGACAGTACTCGAGTACTGTCGCCGGAGTTGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022054.2-1940s21c1
Sequence:CCGGCATTGCCTTGTTTCATTAATCCTCGAGGATTAATGAAACAAGGCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022054.2-1867s21c1
Sequence:CCGGGCTTGTCTCCTGATCCTTATTCTCGAGAATAAGGATCAGGAGACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022054.2-1700s21c1
Sequence:CCGGGAGTAGAATGGAGGATGATTGCTCGAGCAATCATCCTCCATTCTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022054
KCNK13 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 13
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022054.2-1021s1c1
Sequence:CCGGCGTGTACTACGTCATGCTGATCTCGAGATCAGCATGACGTAGTACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022054.2-889s1c1
Sequence:CCGGGATCACCATCATCGCCTACATCTCGAGATGTAGGCGATGATGGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022054.2-760s1c1
Sequence:CCGGCGTCGTTTCCACCATAGGGTTCTCGAGAACCCTATGGTGGAAACGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022054.2-1477s1c1
Sequence:CCGGGATGATCTCCATGAAGGACTTCTCGAGAAGTCCTTCATGGAGATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022054.2-1285s1c1
Sequence:CCGGCCTCATCAAACAGTCCTTGAACTCGAGTTCAAGGACTGTTTGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022054.2-785s21c1
Sequence:CCGGATGACAACTCCGGCGACAGTACTCGAGTACTGTCGCCGGAGTTGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022054.2-1940s21c1
Sequence:CCGGCATTGCCTTGTTTCATTAATCCTCGAGGATTAATGAAACAAGGCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022054.2-1867s21c1
Sequence:CCGGGCTTGTCTCCTGATCCTTATTCTCGAGAATAAGGATCAGGAGACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418215    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022054.2-1700s21c1
Sequence:CCGGGAGTAGAATGGAGGATGATTGCTCGAGCAATCATCCTCCATTCTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)