EMAIL THIS PAGE TO A FRIEND

KCNK15

potassium channel, subfamily K, member 15

47 Gene Product Result for
Synonyms: K2p15.1 KCNK11 KCNK14 KT3.3 TASK-5 TASK5 dJ781B1.1
UniProtKB ID: Q9H427, Q52LL3, Q9HBC8
Gene ID:
Human(60598) Summary: This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel, however, it may require other non-pore-forming proteins for activity. [provided by RefSeq, Jul 2008]
Mouse(241769) potassium channel, subfamily K, member 15
Rat(156873) potassium channel, subfamily K, member 15
Zebrafish(100000132) potassium channel, subfamily K, member 15
chicken(419191) potassium channel, subfamily K, member 15
cow(539593) potassium channel, subfamily K, member 15
domestic cat(101090431) potassium channel, subfamily K, member 15
dog(485887) potassium channel, subfamily K, member 15
domestic guinea pig(100721415) potassium channel, subfamily K, member 15
naked mole-rat(101705716) potassium channel, subfamily K, member 15
sheep(101106869) potassium channel, subfamily K, member 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022358 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_141526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_141526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_141526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022358 Rosetta Predictions human pricing
NM_130813 Rosetta Predictions rat pricing
NM_001030292 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057929 predicted 275
2 SASI_Hs01_00057930 predicted 272
3 SASI_Hs01_00057931 predicted 475
4 SASI_Hs01_00057932 predicted 469
5 SASI_Hs01_00057933 predicted 358
6 SASI_Hs01_00057934 predicted 439
7 SASI_Hs01_00057935 predicted 364
8 SASI_Hs01_00057936 predicted 363
9 SASI_Hs01_00057937 predicted 505
10 SASI_Hs01_00057938 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130813 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075725 predicted 1218
2 SASI_Rn01_00075726 predicted 1140
3 SASI_Rn01_00075727 predicted 629
4 SASI_Rn02_00267506 predicted 354
5 SASI_Rn01_00075728 predicted 1127
6 SASI_Rn01_00075729 predicted 1421
7 SASI_Rn01_00075731 predicted 1396
8 SASI_Rn01_00075732 predicted 1440
9 SASI_Rn01_00075733 predicted 686
10 SASI_Rn01_00075734 predicted 1065
11 SASI_Rn01_00075730 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125559 predicted 659
2 SASI_Mm01_00125560 predicted 577
3 SASI_Mm01_00125561 predicted 602
4 SASI_Mm01_00125562 predicted 212
5 SASI_Mm01_00125563 predicted 207
6 SASI_Mm01_00125564 predicted 513
7 SASI_Mm01_00125565 predicted 663
8 SASI_Mm01_00125566 predicted 599
9 SASI_Mm01_00125567 predicted 681
10 SASI_Mm01_00125568 predicted 588
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022358
KCNK15 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 15
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022358.2-370s21c1
Sequence:CCGGTACGGACTCCGGCAAGGTCTTCTCGAGAAGACCTTGCCGGAGTCCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022358.2-1071s21c1
Sequence:CCGGGCCAGGGTCGAATCTGGAATGCTCGAGCATTCCAGATTCGACCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022358.2-98s21c1
Sequence:CCGGGTCCTGTGCACCCTGTGTTACCTCGAGGTAACACAGGGTGCACAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022358.2-1136s1c1
Sequence:CCGGGAAACGGATGACGGGCCTCTACTCGAGTAGAGGCCCGTCATCCGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022358.2-379s1c1
Sequence:CCGGCGGCAAGGTCTTCTGCATGTTCTCGAGAACATGCAGAAGACCTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022358.2-625s1c1
Sequence:CCGGCCACGCCTACTACTACTGCTTCTCGAGAAGCAGTAGTAGTAGGCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022358.2-922s1c1
Sequence:CCGGCGCCTCTGTCTTCTGCCACGTCTCGAGACGTGGCAGAAGACAGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022358.2-427s1c1
Sequence:CCGGGCTGGTCACTTTCCAGAGCCTCTCGAGAGGCTCTGGAAAGTGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022358
KCNK15 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 15
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022358.2-370s21c1
Sequence:CCGGTACGGACTCCGGCAAGGTCTTCTCGAGAAGACCTTGCCGGAGTCCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022358.2-1071s21c1
Sequence:CCGGGCCAGGGTCGAATCTGGAATGCTCGAGCATTCCAGATTCGACCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022358.2-98s21c1
Sequence:CCGGGTCCTGTGCACCCTGTGTTACCTCGAGGTAACACAGGGTGCACAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022358.2-1136s1c1
Sequence:CCGGGAAACGGATGACGGGCCTCTACTCGAGTAGAGGCCCGTCATCCGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022358.2-379s1c1
Sequence:CCGGCGGCAAGGTCTTCTGCATGTTCTCGAGAACATGCAGAAGACCTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022358.2-625s1c1
Sequence:CCGGCCACGCCTACTACTACTGCTTCTCGAGAAGCAGTAGTAGTAGGCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022358.2-922s1c1
Sequence:CCGGCGCCTCTGTCTTCTGCCACGTCTCGAGACGTGGCAGAAGACAGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022358.2-427s1c1
Sequence:CCGGGCTGGTCACTTTCCAGAGCCTCTCGAGAGGCTCTGGAAAGTGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022358
KCNK15 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 15
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022358.2-370s21c1
Sequence:CCGGTACGGACTCCGGCAAGGTCTTCTCGAGAAGACCTTGCCGGAGTCCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022358.2-1071s21c1
Sequence:CCGGGCCAGGGTCGAATCTGGAATGCTCGAGCATTCCAGATTCGACCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022358.2-98s21c1
Sequence:CCGGGTCCTGTGCACCCTGTGTTACCTCGAGGTAACACAGGGTGCACAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022358.2-1136s1c1
Sequence:CCGGGAAACGGATGACGGGCCTCTACTCGAGTAGAGGCCCGTCATCCGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022358.2-379s1c1
Sequence:CCGGCGGCAAGGTCTTCTGCATGTTCTCGAGAACATGCAGAAGACCTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022358.2-625s1c1
Sequence:CCGGCCACGCCTACTACTACTGCTTCTCGAGAAGCAGTAGTAGTAGGCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022358.2-922s1c1
Sequence:CCGGCGCCTCTGTCTTCTGCCACGTCTCGAGACGTGGCAGAAGACAGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022358.2-427s1c1
Sequence:CCGGGCTGGTCACTTTCCAGAGCCTCTCGAGAGGCTCTGGAAAGTGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_141526
KCNK15 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141526.2-621s1c1
Sequence:CCGGCGCCTACTACTACTGCTTCATCTCGAGATGAAGCAGTAGTAGTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141526.2-90s1c1
Sequence:CCGGCATTCTGTGCATCCTGTCCTACTCGAGTAGGACAGGATGCACAGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141526.2-198s1c1
Sequence:CCGGGTTCCGCAGAAAGTACCGCTTCTCGAGAAGCGGTACTTTCTGCGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141526.2-444s1c1
Sequence:CCGGCGAGCGTCTAAACACACTGGTCTCGAGACCAGTGTGTTTAGACGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141526.2-513s1c1
Sequence:CCGGGCACGTCTCTGCTGAGAACATCTCGAGATGTTCTCAGCAGAGACGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_141526
KCNK15 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141526.2-621s1c1
Sequence:CCGGCGCCTACTACTACTGCTTCATCTCGAGATGAAGCAGTAGTAGTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141526.2-90s1c1
Sequence:CCGGCATTCTGTGCATCCTGTCCTACTCGAGTAGGACAGGATGCACAGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141526.2-198s1c1
Sequence:CCGGGTTCCGCAGAAAGTACCGCTTCTCGAGAAGCGGTACTTTCTGCGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141526.2-444s1c1
Sequence:CCGGCGAGCGTCTAAACACACTGGTCTCGAGACCAGTGTGTTTAGACGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141526.2-513s1c1
Sequence:CCGGGCACGTCTCTGCTGAGAACATCTCGAGATGTTCTCAGCAGAGACGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_141526
KCNK15 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141526.2-621s1c1
Sequence:CCGGCGCCTACTACTACTGCTTCATCTCGAGATGAAGCAGTAGTAGTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141526.2-90s1c1
Sequence:CCGGCATTCTGTGCATCCTGTCCTACTCGAGTAGGACAGGATGCACAGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141526.2-198s1c1
Sequence:CCGGGTTCCGCAGAAAGTACCGCTTCTCGAGAAGCGGTACTTTCTGCGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141526.2-444s1c1
Sequence:CCGGCGAGCGTCTAAACACACTGGTCTCGAGACCAGTGTGTTTAGACGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_141526.2-513s1c1
Sequence:CCGGGCACGTCTCTGCTGAGAACATCTCGAGATGTTCTCAGCAGAGACGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)