EMAIL THIS PAGE TO A FRIEND

KCNK16

potassium channel, subfamily K, member 16

61 Gene Product Result for
Synonyms: K2p16.1 TALK-1 TALK1
Gene ID:
Human(83795) Summary: The protein encoded by this gene belongs to the family of potassium channel proteins containing two pore-forming P domains. This channel is an open rectifier which primarily passes outward current under physiological K+ concentrations. This gene is expressed predominantly in the pancreas and is activated at alkaline pH. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Sep 2008]
Mouse(74571) potassium channel, subfamily K, member 16
Rat(688996) potassium channel, subfamily K, member 16
sheep(101105955) potassium channel, subfamily K, member 16
naked mole-rat(101704540) potassium channel, subfamily K, member 16
chicken(772022) potassium channel, subfamily K, member 16
cow(615960) potassium channel, subfamily K, member 16
domestic cat(101085632) potassium channel, subfamily K, member 16
dog(481781) potassium channel, subfamily K, member 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032115 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032115 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032115 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_138942 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_138942 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_138942 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_029006 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029006 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029006 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032115 Rosetta Predictions human pricing
NM_001109520 Rosetta Predictions rat pricing
XM_138942 Rosetta Predictions mouse pricing
XM_907162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148945 predicted 670
2 SASI_Hs02_00359309 predicted 669
3 SASI_Hs01_00148948 predicted 271
4 SASI_Hs01_00148949 predicted 306
5 SASI_Hs01_00148951 predicted 400
6 SASI_Hs01_00148952 predicted 378
7 SASI_Hs02_00359310 predicted 581
8 SASI_Hs01_00148953 predicted 585
9 SASI_Hs02_00359311 predicted 385
10 SASI_Hs02_00359312 predicted 301
11 SASI_Hs01_00148946 predicted 934
12 SASI_Hs01_00148947 predicted 606
13 SASI_Hs01_00148950 predicted 450
14 SASI_Hs01_00148954 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109520 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249209 predicted 1356
2 SASI_Rn02_00249210 predicted 1233
3 SASI_Rn02_00249211 predicted 279
4 SASI_Rn02_00249212 predicted 676
5 SASI_Rn02_00249213 predicted 404
6 SASI_Rn02_00249214 predicted 1199
7 SASI_Rn02_00249215 predicted 225
8 SASI_Rn02_00249216 predicted 320
9 SASI_Rn02_00249217 predicted 594
10 SASI_Rn02_00249218 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_138942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225202 predicted 595
2 SASI_Mm01_00225203 predicted 581
3 SASI_Mm01_00225204 predicted 599
4 SASI_Mm01_00225206 predicted 591
5 SASI_Mm01_00225207 predicted 611
6 SASI_Mm01_00225208 predicted 595
7 SASI_Mm01_00225209 predicted 582
8 SASI_Mm01_00225210 predicted 527
9 SASI_Mm01_00225211 predicted 572
10 SASI_Mm02_00424841 predicted 612
11 SASI_Mm01_00225205 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433099 predicted 601
2 SASI_Mm02_00433100 predicted 356
3 SASI_Mm02_00433101 predicted 583
4 SASI_Mm02_00433102 predicted 601
5 SASI_Mm02_00433103 predicted 316
6 SASI_Mm02_00433104 predicted 402
7 SASI_Mm02_00433105 predicted 304
8 SASI_Mm02_00433106 predicted 441
9 SASI_Mm02_00433107 predicted 610
10 SASI_Mm02_00433108 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032115
KCNK16 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 16
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032115.2-600s1c1
Sequence:CCGGCGAGGGCTTCTACTTTGCTTTCTCGAGAAAGCAAAGTAGAAGCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032115.2-85s1c1
Sequence:CCGGGCCACTATCTTCCAGCTGCTACTCGAGTAGCAGCTGGAAGATAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032115.2-402s1c1
Sequence:CCGGGCTTAACGTGATCTTCCTCAACTCGAGTTGAGGAAGATCACGTTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032115.2-674s1c1
Sequence:CCGGGCAAGCATTATATCTCAGTGTCTCGAGACACTGAGATATAATGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032115.2-312s1c1
Sequence:CCGGAGTTGTCACTACCATAGGATACTCGAGTATCCTATGGTAGTGACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032115.3-292s21c1
Sequence:CCGGGGGACTTTGGCAGCAGTTTCTCTCGAGAGAAACTGCTGCCAAAGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032115.3-1068s21c1
Sequence:CCGGCTCATGGACAAGTGGCAATCACTCGAGTGATTGCCACTTGTCCATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032115
KCNK16 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 16
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032115.2-600s1c1
Sequence:CCGGCGAGGGCTTCTACTTTGCTTTCTCGAGAAAGCAAAGTAGAAGCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032115.2-85s1c1
Sequence:CCGGGCCACTATCTTCCAGCTGCTACTCGAGTAGCAGCTGGAAGATAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032115.2-402s1c1
Sequence:CCGGGCTTAACGTGATCTTCCTCAACTCGAGTTGAGGAAGATCACGTTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032115.2-674s1c1
Sequence:CCGGGCAAGCATTATATCTCAGTGTCTCGAGACACTGAGATATAATGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032115.2-312s1c1
Sequence:CCGGAGTTGTCACTACCATAGGATACTCGAGTATCCTATGGTAGTGACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032115.3-292s21c1
Sequence:CCGGGGGACTTTGGCAGCAGTTTCTCTCGAGAGAAACTGCTGCCAAAGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032115.3-1068s21c1
Sequence:CCGGCTCATGGACAAGTGGCAATCACTCGAGTGATTGCCACTTGTCCATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032115
KCNK16 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 16
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032115.2-600s1c1
Sequence:CCGGCGAGGGCTTCTACTTTGCTTTCTCGAGAAAGCAAAGTAGAAGCCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032115.2-85s1c1
Sequence:CCGGGCCACTATCTTCCAGCTGCTACTCGAGTAGCAGCTGGAAGATAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032115.2-402s1c1
Sequence:CCGGGCTTAACGTGATCTTCCTCAACTCGAGTTGAGGAAGATCACGTTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032115.2-674s1c1
Sequence:CCGGGCAAGCATTATATCTCAGTGTCTCGAGACACTGAGATATAATGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032115.2-312s1c1
Sequence:CCGGAGTTGTCACTACCATAGGATACTCGAGTATCCTATGGTAGTGACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032115.3-292s21c1
Sequence:CCGGGGGACTTTGGCAGCAGTTTCTCTCGAGAGAAACTGCTGCCAAAGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032115.3-1068s21c1
Sequence:CCGGCTCATGGACAAGTGGCAATCACTCGAGTGATTGCCACTTGTCCATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_138942
KCNK16 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138942.1-299s1c1
Sequence:CCGGCCAAACAACAAGCCAAGCAAACTCGAGTTTGCTTGGCTTGTTGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138942.1-153s1c1
Sequence:CCGGGCTACGCTTCTTAGAGAACTACTCGAGTAGTTCTCTAAGAAGCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138942.1-810s1c1
Sequence:CCGGCAAGCATTACATCGCTGTGTACTCGAGTACACAGCGATGTAATGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138942.1-841s1c1
Sequence:CCGGGCAGCTATATGGATCCTCCTACTCGAGTAGGAGGATCCATATAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138942.1-55s1c1
Sequence:CCGGCTGGCCTATATCTGCTACCTACTCGAGTAGGTAGCAGATATAGGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_138942
KCNK16 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138942.1-299s1c1
Sequence:CCGGCCAAACAACAAGCCAAGCAAACTCGAGTTTGCTTGGCTTGTTGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138942.1-153s1c1
Sequence:CCGGGCTACGCTTCTTAGAGAACTACTCGAGTAGTTCTCTAAGAAGCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138942.1-810s1c1
Sequence:CCGGCAAGCATTACATCGCTGTGTACTCGAGTACACAGCGATGTAATGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138942.1-841s1c1
Sequence:CCGGGCAGCTATATGGATCCTCCTACTCGAGTAGGAGGATCCATATAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138942.1-55s1c1
Sequence:CCGGCTGGCCTATATCTGCTACCTACTCGAGTAGGTAGCAGATATAGGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_138942
KCNK16 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138942.1-299s1c1
Sequence:CCGGCCAAACAACAAGCCAAGCAAACTCGAGTTTGCTTGGCTTGTTGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138942.1-153s1c1
Sequence:CCGGGCTACGCTTCTTAGAGAACTACTCGAGTAGTTCTCTAAGAAGCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138942.1-810s1c1
Sequence:CCGGCAAGCATTACATCGCTGTGTACTCGAGTACACAGCGATGTAATGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138942.1-841s1c1
Sequence:CCGGGCAGCTATATGGATCCTCCTACTCGAGTAGGAGGATCCATATAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_138942.1-55s1c1
Sequence:CCGGCTGGCCTATATCTGCTACCTACTCGAGTAGGTAGCAGATATAGGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029006
KCNK16 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 16
Mouse
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000450477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029006.1-649s21c1
Sequence:CCGGGACTATGTTGTTGGCACAGACCTCGAGGTCTGTGCCAACAACATAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029006
KCNK16 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 16
Mouse
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000450477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029006.1-649s21c1
Sequence:CCGGGACTATGTTGTTGGCACAGACCTCGAGGTCTGTGCCAACAACATAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029006
KCNK16 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 16
Mouse
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000450477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029006.1-649s21c1
Sequence:CCGGGACTATGTTGTTGGCACAGACCTCGAGGTCTGTGCCAACAACATAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)