EMAIL THIS PAGE TO A FRIEND

KCNK17

potassium channel, subfamily K, member 17

44 Gene Product Result for
Synonyms: K2p17.1 TALK-2 TALK2 TASK-4 TASK4
UniProtKB ID: Q96T54, E9PB46, Q5TCF4, Q8TAW4, Q9BXD1, Q9H592
Gene ID:
Human(89822) Summary: The protein encoded by this gene belongs to the family of potassium channel proteins containing two pore-forming P domains. This channel is an open rectifier which primarily passes outward current under physiological K+ concentrations. This gene is activated at alkaline pH. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
chicken(421423) potassium channel, subfamily K, member 17
cow(282264) potassium channel, subfamily K, member 17
domestic cat(101095979) potassium channel, subfamily K, member 17
sheep(101105697) potassium channel, subfamily K, member 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031460 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084301 MISSION® esiRNA esiRNA human KCNK17 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031460 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228795 predicted 766
2 SASI_Hs01_00228797 predicted 375
3 SASI_Hs01_00228798 predicted 372
4 SASI_Hs01_00228799 predicted 370
5 SASI_Hs01_00228800 predicted 508
6 SASI_Hs02_00358883 predicted 840
7 SASI_Hs01_00228801 predicted 315
8 SASI_Hs01_00228802 predicted 810
9 SASI_Hs01_00228804 predicted 895
10 SASI_Hs02_00358884 predicted 301
11 SASI_Hs01_00228796 predicted 846
12 SASI_Hs01_00228803 predicted 709
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031460
KCNK17 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 17
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031460.2-1036s1c1
Sequence:CCGGCCCATGGGAATCATACAGCATCTCGAGATGCTGTATGATTCCCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031460.2-777s1c1
Sequence:CCGGCGACTACGTGATTGGAATGAACTCGAGTTCATTCCAATCACGTAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031460.2-490s1c1
Sequence:CCGGCGCCTCTTCTGCATCTTCTTTCTCGAGAAAGAAGATGCAGAAGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031460.2-340s1c1
Sequence:CCGGGATGTCGTCCAAGCATACAAACTCGAGTTTGTATGCTTGGACGACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031460.2-936s1c1
Sequence:CCGGCCACAGCTCTAAGGAAGACTTCTCGAGAAGTCTTCCTTAGAGCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031460
KCNK17 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 17
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031460.2-1036s1c1
Sequence:CCGGCCCATGGGAATCATACAGCATCTCGAGATGCTGTATGATTCCCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031460.2-777s1c1
Sequence:CCGGCGACTACGTGATTGGAATGAACTCGAGTTCATTCCAATCACGTAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031460.2-490s1c1
Sequence:CCGGCGCCTCTTCTGCATCTTCTTTCTCGAGAAAGAAGATGCAGAAGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031460.2-340s1c1
Sequence:CCGGGATGTCGTCCAAGCATACAAACTCGAGTTTGTATGCTTGGACGACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031460.2-936s1c1
Sequence:CCGGCCACAGCTCTAAGGAAGACTTCTCGAGAAGTCTTCCTTAGAGCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031460
KCNK17 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 17
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031460.2-1036s1c1
Sequence:CCGGCCCATGGGAATCATACAGCATCTCGAGATGCTGTATGATTCCCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031460.2-777s1c1
Sequence:CCGGCGACTACGTGATTGGAATGAACTCGAGTTCATTCCAATCACGTAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031460.2-490s1c1
Sequence:CCGGCGCCTCTTCTGCATCTTCTTTCTCGAGAAAGAAGATGCAGAAGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031460.2-340s1c1
Sequence:CCGGGATGTCGTCCAAGCATACAAACTCGAGTTTGTATGCTTGGACGACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031460.2-936s1c1
Sequence:CCGGCCACAGCTCTAAGGAAGACTTCTCGAGAAGTCTTCCTTAGAGCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)