EMAIL THIS PAGE TO A FRIEND

KCNK18

potassium channel, subfamily K, member 18

64 Gene Product Result for
Synonyms: K2p18.1 MGR13 TRESK TRESK-2 TRESK2 TRIK
UniProtKB ID: Q7Z418, Q5SQQ8
Gene ID:
Human(338567) Summary: Potassium channels play a role in many cellular processes including maintenance of the action potential, muscle contraction, hormone secretion, osmotic regulation, and ion flow. This gene encodes a member of the superfamily of potassium channel proteins containing two pore-forming P domains and the encoded protein functions as an outward rectifying potassium channel. A mutation in this gene has been found to be associated with migraine with aura.[provided by RefSeq, Jan 2011]
Mouse(332396) potassium channel, subfamily K, member 18
Rat(445371) potassium channel, subfamily K, member 18
sheep(101121389) potassium channel, subfamily K, member 18
domestic guinea pig(100719381) potassium channel, subfamily K, member 18
naked mole-rat(101725968) potassium channel, subfamily K, member 18
Zebrafish(561821) potassium channel, subfamily K, member 18
cow(538791) potassium channel, subfamily K, member 18
chicken(771448) potassium channel, subfamily K, member 18
domestic cat(101084487) potassium channel, subfamily K, member 18
dog(486907) potassium channel, subfamily K, member 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207261 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207261 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207261 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181840 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181840 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181840 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU079501 MISSION® esiRNA esiRNA targeting mouse Kcnk18 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181840 Rosetta Predictions human pricing
NM_001003820 Rosetta Predictions rat pricing
NM_001134912 Rosetta Predictions rat pricing
NM_207261 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370430 predicted 683
2 SASI_Hs01_00213648 predicted 745
3 SASI_Hs01_00213650 predicted 463
4 SASI_Hs01_00213651 predicted 457
5 SASI_Hs01_00213652 predicted 847
6 SASI_Hs01_00213653 predicted 208
7 SASI_Hs01_00213654 predicted 266
8 SASI_Hs01_00213655 predicted 778
9 SASI_Hs01_00213656 predicted 395
10 SASI_Hs01_00213657 predicted 639
11 SASI_Hs01_00213649 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003820 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091878 predicted 718
2 SASI_Rn02_00198062 predicted 845
3 SASI_Rn01_00091883 predicted 848
4 SASI_Rn02_00198063 predicted 645
5 SASI_Rn01_00091884 predicted 686
6 SASI_Rn01_00091886 predicted 924
7 SASI_Rn02_00198064 predicted 989
8 SASI_Rn02_00198065 predicted 748
9 SASI_Rn02_00198066 predicted 851
10 SASI_Rn02_00198067 predicted 764
11 SASI_Rn01_00091877 predicted 731
12 SASI_Rn01_00091879 predicted 264
13 SASI_Rn01_00091880 predicted 530
14 SASI_Rn01_00091881 predicted 451
15 SASI_Rn01_00091882 predicted 476
16 SASI_Rn01_00091885 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134912 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259034 predicted 624
2 SASI_Rn02_00259035 predicted 759
3 SASI_Rn02_00259036 predicted 754
4 SASI_Rn02_00259037 predicted 550
5 SASI_Rn02_00259038 predicted 591
6 SASI_Rn02_00259039 predicted 830
7 SASI_Rn02_00259040 predicted 563
8 SASI_Rn02_00259041 predicted 899
9 SASI_Rn02_00259042 predicted 661
10 SASI_Rn02_00259043 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207261 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084495 predicted 312
2 SASI_Mm01_00084497 predicted 362
3 SASI_Mm01_00084498 predicted 903
4 SASI_Mm02_00352001 predicted 349
5 SASI_Mm01_00084499 predicted 1360
6 SASI_Mm01_00084500 predicted 529
7 SASI_Mm02_00352002 predicted 743
8 SASI_Mm01_00084501 predicted 802
9 SASI_Mm01_00084503 predicted 1255
10 SASI_Mm01_00084504 predicted 585
11 SASI_Mm01_00084496 predicted 459
12 SASI_Mm01_00084502 predicted 1064
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207261
KCNK18 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 18
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207261.1-622s1c1
Sequence:CCGGGCCATCCCTCAGATTGTCATTCTCGAGAATGACAATCTGAGGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207261.1-712s1c1
Sequence:CCGGGAGCTGTTTGAGAGATTAGTTCTCGAGAACTAATCTCTCAAACAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207261.1-237s1c1
Sequence:CCGGCCTGAAATGTAACCTGACAGTCTCGAGACTGTCAGGTTACATTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207261.1-223s1c1
Sequence:CCGGGATCTGTGCAACATCCTGAAACTCGAGTTTCAGGATGTTGCACAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207261.1-501s1c1
Sequence:CCGGCACCATCTTATCCAGGGCTTACTCGAGTAAGCCCTGGATAAGATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207261
KCNK18 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 18
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207261.1-622s1c1
Sequence:CCGGGCCATCCCTCAGATTGTCATTCTCGAGAATGACAATCTGAGGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207261.1-712s1c1
Sequence:CCGGGAGCTGTTTGAGAGATTAGTTCTCGAGAACTAATCTCTCAAACAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207261.1-237s1c1
Sequence:CCGGCCTGAAATGTAACCTGACAGTCTCGAGACTGTCAGGTTACATTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207261.1-223s1c1
Sequence:CCGGGATCTGTGCAACATCCTGAAACTCGAGTTTCAGGATGTTGCACAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207261.1-501s1c1
Sequence:CCGGCACCATCTTATCCAGGGCTTACTCGAGTAAGCCCTGGATAAGATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207261
KCNK18 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 18
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207261.1-622s1c1
Sequence:CCGGGCCATCCCTCAGATTGTCATTCTCGAGAATGACAATCTGAGGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207261.1-712s1c1
Sequence:CCGGGAGCTGTTTGAGAGATTAGTTCTCGAGAACTAATCTCTCAAACAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207261.1-237s1c1
Sequence:CCGGCCTGAAATGTAACCTGACAGTCTCGAGACTGTCAGGTTACATTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207261.1-223s1c1
Sequence:CCGGGATCTGTGCAACATCCTGAAACTCGAGTTTCAGGATGTTGCACAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207261.1-501s1c1
Sequence:CCGGCACCATCTTATCCAGGGCTTACTCGAGTAAGCCCTGGATAAGATGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181840
KCNK18 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 18
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181840.1-482s1c1
Sequence:CCGGCATCTTATAATCGGTTCCGAACTCGAGTTCGGAACCGATTATAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181840.1-999s1c1
Sequence:CCGGCCCTAACTTCTTCCTGTTCTTCTCGAGAAGAACAGGAAGAAGTTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181840.1-676s1c1
Sequence:CCGGGAGCTGTTTGAGAGATCTCATCTCGAGATGAGATCTCTCAAACAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181840.1-601s1c1
Sequence:CCGGCAGATCATCATCAGTGCTGAACTCGAGTTCAGCACTGATGATGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181840.1-466s1c1
Sequence:CCGGGCAACCATCTTATCTACATCTCTCGAGAGATGTAGATAAGATGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181840
KCNK18 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 18
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181840.1-482s1c1
Sequence:CCGGCATCTTATAATCGGTTCCGAACTCGAGTTCGGAACCGATTATAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181840.1-999s1c1
Sequence:CCGGCCCTAACTTCTTCCTGTTCTTCTCGAGAAGAACAGGAAGAAGTTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181840.1-676s1c1
Sequence:CCGGGAGCTGTTTGAGAGATCTCATCTCGAGATGAGATCTCTCAAACAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181840.1-601s1c1
Sequence:CCGGCAGATCATCATCAGTGCTGAACTCGAGTTCAGCACTGATGATGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181840.1-466s1c1
Sequence:CCGGGCAACCATCTTATCTACATCTCTCGAGAGATGTAGATAAGATGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181840
KCNK18 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 18
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181840.1-482s1c1
Sequence:CCGGCATCTTATAATCGGTTCCGAACTCGAGTTCGGAACCGATTATAAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181840.1-999s1c1
Sequence:CCGGCCCTAACTTCTTCCTGTTCTTCTCGAGAAGAACAGGAAGAAGTTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181840.1-676s1c1
Sequence:CCGGGAGCTGTTTGAGAGATCTCATCTCGAGATGAGATCTCTCAAACAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181840.1-601s1c1
Sequence:CCGGCAGATCATCATCAGTGCTGAACTCGAGTTCAGCACTGATGATGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181840.1-466s1c1
Sequence:CCGGGCAACCATCTTATCTACATCTCTCGAGAGATGTAGATAAGATGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)