EMAIL THIS PAGE TO A FRIEND

KCNK2

potassium channel, subfamily K, member 2

308 Gene Product Result for
Synonyms: K2p2.1 TPKC1 TREK TREK-1 TREK1 hTREK-1c hTREK-1e
Gene ID:
Human(3776) Summary: This gene encodes one of the members of the two-pore-domain background potassium channel protein family. This type of potassium channel is formed by two homodimers that create a channel that leaks potassium out of the cell to control resting membrane potential. The channel can be opened, however, by certain anesthetics, membrane stretching, intracellular acidosis, and heat. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16526) potassium channel, subfamily K, member 2
Rat(170899) potassium channel, subfamily K, member 2
chicken(770954) potassium channel, subfamily K, member 2
dog(490295) potassium channel, subfamily K, member 2
Horse(100050114) potassium channel, subfamily K, member 2
cow(282590) potassium channel, subfamily K, member 2
domestic cat(101096695) potassium channel, subfamily K, member 2
domestic guinea pig(100729832) potassium channel, subfamily K, member 2
naked mole-rat(101722094) potassium channel, subfamily K, member 2
sheep(101111729) potassium channel, subfamily K, member 2
Domestic Rabbit(100356478) potassium channel, subfamily K, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014217 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014217 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014217 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010607 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010607 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010607 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017424 Rosetta Predictions human pricing
NM_001017425 Rosetta Predictions human pricing
NM_014217 Rosetta Predictions human pricing
NM_172041 Rosetta Predictions rat pricing
NM_172042 Rosetta Predictions rat pricing
NM_010607 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306750 predicted 1146
2 SASI_Hs02_00306751 predicted 719
3 SASI_Hs01_00018575 predicted 1573
4 SASI_Hs02_00306752 predicted 760
5 SASI_Hs01_00018577 predicted 1647
6 SASI_Hs02_00306753 predicted 826
7 SASI_Hs02_00306754 predicted 1053
8 SASI_Hs01_00018579 predicted 1619
9 SASI_Hs01_00018580 predicted 676
10 SASI_Hs01_00018581 predicted 1390
11 SASI_Hs01_00018574 predicted 1389
12 SASI_Hs01_00018576 predicted 1029
13 SASI_Hs01_00018578 predicted 950
14 SASI_Hs01_00018582 predicted 1447
15 SASI_Hs01_00018583 predicted 428
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209726 predicted 1436
2 SASI_Hs01_00209727 predicted 1372
3 SASI_Hs01_00209728 predicted 1087
4 SASI_Hs01_00209729 predicted 1448
5 SASI_Hs01_00209731 predicted 1424
6 SASI_Hs01_00209732 predicted 471
7 SASI_Hs01_00209733 predicted 1187
8 SASI_Hs01_00209734 predicted 1504
9 SASI_Hs01_00209735 predicted 475
10 SASI_Hs02_00306755 predicted 1445
11 SASI_Hs01_00209730 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345240 predicted 824
2 SASI_Hs02_00345241 predicted 401
3 SASI_Hs01_00143111 predicted 1249
4 SASI_Hs02_00345242 predicted 435
5 SASI_Hs01_00143113 predicted 1325
6 SASI_Hs02_00345243 predicted 498
7 SASI_Hs02_00345244 predicted 732
8 SASI_Hs01_00143115 predicted 1301
9 SASI_Hs01_00143116 predicted 348
10 SASI_Hs01_00143117 predicted 1065
11 SASI_Hs01_00143110 predicted 1240
12 SASI_Hs01_00143112 predicted 893
13 SASI_Hs01_00143114 predicted 804
14 SASI_Hs01_00143118 predicted 1314
15 SASI_Hs01_00143119 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269135 predicted 404
2 SASI_Rn02_00269136 predicted 668
3 SASI_Rn02_00269137 predicted 327
4 SASI_Rn02_00269138 predicted 635
5 SASI_Rn02_00269139 predicted 417
6 SASI_Rn02_00269140 predicted 628
7 SASI_Rn01_00061375 predicted 406
8 SASI_Rn01_00061376 predicted 513
9 SASI_Rn02_00269141 predicted 509
10 SASI_Rn02_00269142 predicted 311
11 SASI_Rn01_00061373 predicted 491
12 SASI_Rn01_00061374 predicted 951
13 SASI_Rn01_00061377 predicted 928
14 SASI_Rn01_00061378 predicted 426
15 SASI_Rn01_00061379 predicted 778
16 SASI_Rn01_00061380 predicted 943
17 SASI_Rn01_00061381 predicted 596
18 SASI_Rn01_00061382 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269143 predicted 396
2 SASI_Rn02_00269144 predicted 652
3 SASI_Rn02_00269145 predicted 311
4 SASI_Rn02_00269146 predicted 625
5 SASI_Rn02_00269147 predicted 405
6 SASI_Rn02_00269148 predicted 615
7 SASI_Rn01_00111703 predicted 395
8 SASI_Rn01_00111704 predicted 501
9 SASI_Rn02_00269149 predicted 492
10 SASI_Rn02_00269150 predicted 295
11 SASI_Rn01_00111700 predicted 386
12 SASI_Rn01_00111701 predicted 839
13 SASI_Rn01_00111702 predicted 1417
14 SASI_Rn01_00111705 predicted 821
15 SASI_Rn01_00111706 predicted 321
16 SASI_Rn01_00111707 predicted 667
17 SASI_Rn01_00111708 predicted 833
18 SASI_Rn01_00111709 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010607 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122563 predicted 799
2 SASI_Mm01_00122564 predicted 790
3 SASI_Mm01_00122565 predicted 1023
4 SASI_Mm01_00122566 predicted 788
5 SASI_Mm01_00122567 predicted 786
6 SASI_Mm01_00122568 predicted 1061
7 SASI_Mm01_00122569 predicted 1059
8 SASI_Mm01_00122570 predicted 823
9 SASI_Mm01_00122571 predicted 895
10 SASI_Mm01_00122572 predicted 1488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014217
KCNK2 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014217.1-336s1c1
Sequence:CCGGGCAGCAATAAATGCAGGGATTCTCGAGAATCCCTGCATTTATTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014217.1-583s1c1
Sequence:CCGGCCAAAGTGGAAGATACGTTTACTCGAGTAAACGTATCTTCCACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014217.1-1167s1c1
Sequence:CCGGCTGAAGACTGAGAGTATCTATCTCGAGATAGATACTCTCAGTCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014217.1-693s1c1
Sequence:CCGGGCGATCATATTCAAACACATACTCGAGTATGTGTTTGAATATGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014217.1-360s1c1
Sequence:CCGGCCGTTAGGAAACACCTCCAATCTCGAGATTGGAGGTGTTTCCTAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014217.3-1704s21c1
Sequence:CCGGGCCTAGATATGGACCATTTATCTCGAGATAAATGGTCCATATCTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014217.3-710s21c1
Sequence:CCGGGCATCATCTCAACAATCATATCTCGAGATATGATTGTTGAGATGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014217.3-625s21c1
Sequence:CCGGGATCAGCTAGGCACCATATTTCTCGAGAAATATGGTGCCTAGCTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014217.3-968s21c1
Sequence:CCGGGAGATTGGCTCCGAGTGATATCTCGAGATATCACTCGGAGCCAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014217
KCNK2 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014217.1-336s1c1
Sequence:CCGGGCAGCAATAAATGCAGGGATTCTCGAGAATCCCTGCATTTATTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014217.1-583s1c1
Sequence:CCGGCCAAAGTGGAAGATACGTTTACTCGAGTAAACGTATCTTCCACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014217.1-1167s1c1
Sequence:CCGGCTGAAGACTGAGAGTATCTATCTCGAGATAGATACTCTCAGTCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014217.1-693s1c1
Sequence:CCGGGCGATCATATTCAAACACATACTCGAGTATGTGTTTGAATATGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014217.1-360s1c1
Sequence:CCGGCCGTTAGGAAACACCTCCAATCTCGAGATTGGAGGTGTTTCCTAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014217.3-1704s21c1
Sequence:CCGGGCCTAGATATGGACCATTTATCTCGAGATAAATGGTCCATATCTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014217.3-710s21c1
Sequence:CCGGGCATCATCTCAACAATCATATCTCGAGATATGATTGTTGAGATGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014217.3-625s21c1
Sequence:CCGGGATCAGCTAGGCACCATATTTCTCGAGAAATATGGTGCCTAGCTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014217.3-968s21c1
Sequence:CCGGGAGATTGGCTCCGAGTGATATCTCGAGATATCACTCGGAGCCAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014217
KCNK2 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014217.1-336s1c1
Sequence:CCGGGCAGCAATAAATGCAGGGATTCTCGAGAATCCCTGCATTTATTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014217.1-583s1c1
Sequence:CCGGCCAAAGTGGAAGATACGTTTACTCGAGTAAACGTATCTTCCACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014217.1-1167s1c1
Sequence:CCGGCTGAAGACTGAGAGTATCTATCTCGAGATAGATACTCTCAGTCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014217.1-693s1c1
Sequence:CCGGGCGATCATATTCAAACACATACTCGAGTATGTGTTTGAATATGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014217.1-360s1c1
Sequence:CCGGCCGTTAGGAAACACCTCCAATCTCGAGATTGGAGGTGTTTCCTAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014217.3-1704s21c1
Sequence:CCGGGCCTAGATATGGACCATTTATCTCGAGATAAATGGTCCATATCTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014217.3-710s21c1
Sequence:CCGGGCATCATCTCAACAATCATATCTCGAGATATGATTGTTGAGATGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014217.3-625s21c1
Sequence:CCGGGATCAGCTAGGCACCATATTTCTCGAGAAATATGGTGCCTAGCTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014217.3-968s21c1
Sequence:CCGGGAGATTGGCTCCGAGTGATATCTCGAGATATCACTCGGAGCCAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010607
KCNK2 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000028922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010607.1-805s1c1
Sequence:CCGGGCAGCAATAAACGCAGGGATTCTCGAGAATCCCTGCGTTTATTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010607.1-593s1c1
Sequence:CCGGCGGCCATTAATGTTATGAAATCTCGAGATTTCATAACATTAATGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010607.1-1023s1c1
Sequence:CCGGGCTAGGAACTATATTTGGAAACTCGAGTTTCCAAATATAGTTCCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010607.1-1162s1c1
Sequence:CCGGGCGGTCATATTCAAGCACATACTCGAGTATGTGCTTGAATATGACCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010607
KCNK2 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000028922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010607.1-805s1c1
Sequence:CCGGGCAGCAATAAACGCAGGGATTCTCGAGAATCCCTGCGTTTATTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010607.1-593s1c1
Sequence:CCGGCGGCCATTAATGTTATGAAATCTCGAGATTTCATAACATTAATGGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010607.1-1023s1c1
Sequence:CCGGGCTAGGAACTATATTTGGAAACTCGAGTTTCCAAATATAGTTCCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010607.1-1162s1c1
Sequence:CCGGGCGGTCATATTCAAGCACATACTCGAGTATGTGCTTGAATATGACCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010607
KCNK2 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000028922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010607.1-805s1c1
Sequence:CCGGGCAGCAATAAACGCAGGGATTCTCGAGAATCCCTGCGTTTATTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010607.1-593s1c1
Sequence:CCGGCGGCCATTAATGTTATGAAATCTCGAGATTTCATAACATTAATGGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010607.1-1023s1c1
Sequence:CCGGGCTAGGAACTATATTTGGAAACTCGAGTTTCCAAATATAGTTCCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010607.1-1162s1c1
Sequence:CCGGGCGGTCATATTCAAGCACATACTCGAGTATGTGCTTGAATATGACCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)