EMAIL THIS PAGE TO A FRIEND

KCNK4

potassium channel, subfamily K, member 4

51 Gene Product Result for
Synonyms: K2p4.1 TRAAK TRAAK1
UniProtKB ID: Q9NYG8, B5TJL1, Q96T94
Gene ID:
Human(50801) Summary: Potassium channels play a role in many cellular processes including maintenance of the action potential, muscle contraction, hormone secretion, osmotic regulation, and ion flow. This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The encoded protein homodimerizes and functions as an outwardly rectifying channel. It is expressed primarily in neural tissues and is stimulated by membrane stretch and polyunsaturated fatty acids. [provided by RefSeq, Jul 2008]
Mouse(16528) potassium channel, subfamily K, member 4
Rat(116489) potassium channel, subfamily K, member 4
domestic guinea pig(100732561) potassium channel, subfamily K, member 4
naked mole-rat(101723611) potassium channel, subfamily K, member 4
cow(617184) potassium channel, subfamily K, member 4
domestic cat(101099401) potassium channel, subfamily K, member 4
dog(612120) potassium channel, subfamily K, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008431 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008431 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008431 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016611 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016611 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016611 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033310 Rosetta Predictions human pricing
NM_053804 Rosetta Predictions rat pricing
NM_008431 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144999 predicted 876
2 SASI_Hs01_00145001 predicted 873
3 SASI_Hs01_00145002 predicted 946
4 SASI_Hs01_00145004 predicted 777
5 SASI_Hs02_00361150 predicted 649
6 SASI_Hs01_00145005 predicted 882
7 SASI_Hs02_00361151 predicted 843
8 SASI_Hs01_00145006 predicted 653
9 SASI_Hs01_00145007 predicted 634
10 SASI_Hs01_00145008 predicted 703
11 SASI_Hs01_00145000 predicted 925
12 SASI_Hs01_00145003 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037398 predicted 320
2 SASI_Rn01_00037399 predicted 602
3 SASI_Rn01_00037400 predicted 645
4 SASI_Rn01_00037401 predicted 592
5 SASI_Rn01_00037402 predicted 218
6 SASI_Rn01_00037403 predicted 625
7 SASI_Rn01_00037404 predicted 333
8 SASI_Rn01_00037405 predicted 629
9 SASI_Rn01_00037406 predicted 740
10 SASI_Rn01_00037407 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152927 predicted 877
2 SASI_Mm01_00152928 predicted 804
3 SASI_Mm01_00152929 predicted 477
4 SASI_Mm01_00152931 predicted 326
5 SASI_Mm01_00152932 predicted 275
6 SASI_Mm01_00152933 predicted 894
7 SASI_Mm01_00152934 predicted 1068
8 SASI_Mm01_00152935 predicted 560
9 SASI_Mm02_00313904 predicted 403
10 SASI_Mm01_00152936 predicted 1411
11 SASI_Mm01_00152930 predicted 599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008431
KCNK4 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008431.1-1542s1c1
Sequence:CCGGTGCTTGGCTTATTTGACCAAACTCGAGTTTGGTCAAATAAGCCAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008431.1-887s1c1
Sequence:CCGGGAAGCCATCTACTTTGTTATACTCGAGTATAACAAAGTAGATGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008431.1-598s1c1
Sequence:CCGGCGGCTATGGCAATATAGTCTTCTCGAGAAGACTATATTGCCATAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008431.1-318s1c1
Sequence:CCGGTGGTGCTGCTTTACTTGGTATCTCGAGATACCAAGTAAAGCAGCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008431.1-749s1c1
Sequence:CCGGGCAATCTTCTTGAAGTGGCATCTCGAGATGCCACTTCAAGAAGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008431.2-884s21c1
Sequence:CCGGTGTAGGCTTTGGCGATTATGTCTCGAGACATAATCGCCAAAGCCTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008431.2-1288s21c1
Sequence:CCGGATCTGGCCTTCATCGACGAGTCTCGAGACTCGTCGATGAAGGCCAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008431
KCNK4 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008431.1-1542s1c1
Sequence:CCGGTGCTTGGCTTATTTGACCAAACTCGAGTTTGGTCAAATAAGCCAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008431.1-887s1c1
Sequence:CCGGGAAGCCATCTACTTTGTTATACTCGAGTATAACAAAGTAGATGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008431.1-598s1c1
Sequence:CCGGCGGCTATGGCAATATAGTCTTCTCGAGAAGACTATATTGCCATAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008431.1-318s1c1
Sequence:CCGGTGGTGCTGCTTTACTTGGTATCTCGAGATACCAAGTAAAGCAGCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008431.1-749s1c1
Sequence:CCGGGCAATCTTCTTGAAGTGGCATCTCGAGATGCCACTTCAAGAAGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008431.2-884s21c1
Sequence:CCGGTGTAGGCTTTGGCGATTATGTCTCGAGACATAATCGCCAAAGCCTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008431.2-1288s21c1
Sequence:CCGGATCTGGCCTTCATCGACGAGTCTCGAGACTCGTCGATGAAGGCCAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008431
KCNK4 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008431.1-1542s1c1
Sequence:CCGGTGCTTGGCTTATTTGACCAAACTCGAGTTTGGTCAAATAAGCCAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008431.1-887s1c1
Sequence:CCGGGAAGCCATCTACTTTGTTATACTCGAGTATAACAAAGTAGATGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008431.1-598s1c1
Sequence:CCGGCGGCTATGGCAATATAGTCTTCTCGAGAAGACTATATTGCCATAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008431.1-318s1c1
Sequence:CCGGTGGTGCTGCTTTACTTGGTATCTCGAGATACCAAGTAAAGCAGCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008431.1-749s1c1
Sequence:CCGGGCAATCTTCTTGAAGTGGCATCTCGAGATGCCACTTCAAGAAGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008431.2-884s21c1
Sequence:CCGGTGTAGGCTTTGGCGATTATGTCTCGAGACATAATCGCCAAAGCCTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008431.2-1288s21c1
Sequence:CCGGATCTGGCCTTCATCGACGAGTCTCGAGACTCGTCGATGAAGGCCAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016611
KCNK4 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000044463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016611.2-752s1c1
Sequence:CCGGACTTTGTCATAGTGACGCTTACTCGAGTAAGCGTCACTATGACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016611.2-588s1c1
Sequence:CCGGCATCGGTCACATTGAAGCCATCTCGAGATGGCTTCAATGTGACCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016611.2-700s1c1
Sequence:CCGGCCCACGTTCGTGTTCTGCTATCTCGAGATAGCAGAACACGAACGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016611.2-174s1c1
Sequence:CCGGGCTGGTCTTGCTTTACTTGGTCTCGAGACCAAGTAAAGCAAGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016611
KCNK4 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000044463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016611.2-752s1c1
Sequence:CCGGACTTTGTCATAGTGACGCTTACTCGAGTAAGCGTCACTATGACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016611.2-588s1c1
Sequence:CCGGCATCGGTCACATTGAAGCCATCTCGAGATGGCTTCAATGTGACCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016611.2-700s1c1
Sequence:CCGGCCCACGTTCGTGTTCTGCTATCTCGAGATAGCAGAACACGAACGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016611.2-174s1c1
Sequence:CCGGGCTGGTCTTGCTTTACTTGGTCTCGAGACCAAGTAAAGCAAGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016611
KCNK4 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000044463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016611.2-752s1c1
Sequence:CCGGACTTTGTCATAGTGACGCTTACTCGAGTAAGCGTCACTATGACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016611.2-588s1c1
Sequence:CCGGCATCGGTCACATTGAAGCCATCTCGAGATGGCTTCAATGTGACCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016611.2-700s1c1
Sequence:CCGGCCCACGTTCGTGTTCTGCTATCTCGAGATAGCAGAACACGAACGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016611.2-174s1c1
Sequence:CCGGGCTGGTCTTGCTTTACTTGGTCTCGAGACCAAGTAAAGCAAGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)