EMAIL THIS PAGE TO A FRIEND

KCNK5

potassium channel, subfamily K, member 5

66 Gene Product Result for
Synonyms: K2p5.1 TASK-2 TASK2
UniProtKB ID: O95279, B5TJL2, Q5VV76
Gene ID:
Human(8645) Summary: This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The message for this gene is mainly expressed in the cortical distal tubules and collecting ducts of the kidney. The protein is highly sensitive to external pH and this, in combination with its expression pattern, suggests it may play an important role in renal potassium transport. [provided by RefSeq, Jul 2008]
Mouse(16529) potassium channel, subfamily K, member 5
Rat(364241) potassium channel, subfamily K, member 5
chicken(421424) potassium channel, subfamily K, member 5
cow(782166) potassium channel, subfamily K, member 5
Horse(100065337) potassium channel, subfamily K, member 5
domestic cat(101085375) potassium channel, subfamily K, member 5
dog(481780) potassium channel, subfamily K, member 5
sheep(101103020) potassium channel, subfamily K, member 5
Domestic Rabbit(100009446) potassium channel, subfamily K, member 5
domestic guinea pig(100727600) potassium channel, subfamily K, member 5
naked mole-rat(101697230) potassium channel, subfamily K, member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021542 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021542 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021542 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003740 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003740 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003740 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003740 Rosetta Predictions human pricing
NM_001039516 Rosetta Predictions rat pricing
NM_021542 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060940 predicted 981
2 SASI_Hs01_00060941 predicted 2248
3 SASI_Hs01_00060942 predicted 1100
4 SASI_Hs02_00336195 predicted 478
5 SASI_Hs01_00060943 predicted 1265
6 SASI_Hs01_00060944 predicted 2001
7 SASI_Hs01_00060945 predicted 785
8 SASI_Hs01_00060946 predicted 2236
9 SASI_Hs01_00060947 predicted 831
10 SASI_Hs01_00060948 predicted 1443
11 SASI_Hs01_00060949 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039516 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053088 predicted 1411
2 SASI_Rn02_00204846 predicted 1635
3 SASI_Rn02_00204847 predicted 815
4 SASI_Rn02_00204848 predicted 1084
5 SASI_Rn02_00204849 predicted 1426
6 SASI_Rn01_00053095 predicted 966
7 SASI_Rn01_00053097 predicted 1415
8 SASI_Rn02_00204850 predicted 1246
9 SASI_Rn02_00204851 predicted 459
10 SASI_Rn02_00204852 predicted 899
11 SASI_Rn01_00053089 predicted 295
12 SASI_Rn01_00053090 predicted 661
13 SASI_Rn01_00053091 predicted 1231
14 SASI_Rn01_00053092 predicted 1168
15 SASI_Rn01_00053093 predicted 1045
16 SASI_Rn01_00053094 predicted 1032
17 SASI_Rn01_00053096 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021542 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326289 predicted 799
2 SASI_Mm01_00067124 predicted 1401
3 SASI_Mm01_00067125 predicted 1486
4 SASI_Mm01_00067126 predicted 883
5 SASI_Mm01_00067127 predicted 1235
6 SASI_Mm01_00067128 predicted 948
7 SASI_Mm01_00067129 predicted 748
8 SASI_Mm01_00067130 predicted 1064
9 SASI_Mm02_00326290 predicted 1661
10 SASI_Mm01_00067131 predicted 1491
11 SASI_Mm01_00067132 predicted 1234
12 SASI_Mm01_00067133 predicted 1802
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021542
VALIDATED
KCNK5 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021542.2-2620s1c1
Sequence:CCGGCCGTCTCATTTCAGAGAGATTCTCGAGAATCTCTCTGAAATGAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021542.2-556s1c1
Sequence:CCGGCGGGAACCAGACTTTCAACAACTCGAGTTGTTGAAAGTCTGGTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021542.2-1240s1c1
Sequence:CCGGCCTCATCAAACAGATTGGGAACTCGAGTTCCCAATCTGTTTGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021542.2-1804s1c1
Sequence:CCGGCGAATACAACAAGGCAGATAACTCGAGTTATCTGCCTTGTTGTATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021542.2-989s1c1
Sequence:CCGGCACGCCCTATACCGATACTTTCTCGAGAAAGTATCGGTATAGGGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021542.4-581s21c1
Sequence:CCGGACTGGCCCAATGCAATGATTTCTCGAGAAATCATTGCATTGGGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021542.4-555s21c1
Sequence:CCGGCGGGAACCAGACTTTCAACAACTCGAGTTGTTGAAAGTCTGGTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021542.4-1803s21c1
Sequence:CCGGCGAATACAACAAGGCAGATAACTCGAGTTATCTGCCTTGTTGTATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021542.4-2619s21c1
Sequence:CCGGCCGTCTCATTTCAGAGAGATTCTCGAGAATCTCTCTGAAATGAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021542.4-1358s21c1
Sequence:CCGGTGGCACCTTTGGTGGTCTATTCTCGAGAATAGACCACCAAAGGTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021542
VALIDATED
KCNK5 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021542.2-2620s1c1
Sequence:CCGGCCGTCTCATTTCAGAGAGATTCTCGAGAATCTCTCTGAAATGAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021542.2-556s1c1
Sequence:CCGGCGGGAACCAGACTTTCAACAACTCGAGTTGTTGAAAGTCTGGTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021542.2-1240s1c1
Sequence:CCGGCCTCATCAAACAGATTGGGAACTCGAGTTCCCAATCTGTTTGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021542.2-1804s1c1
Sequence:CCGGCGAATACAACAAGGCAGATAACTCGAGTTATCTGCCTTGTTGTATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021542.2-989s1c1
Sequence:CCGGCACGCCCTATACCGATACTTTCTCGAGAAAGTATCGGTATAGGGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021542.4-581s21c1
Sequence:CCGGACTGGCCCAATGCAATGATTTCTCGAGAAATCATTGCATTGGGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021542.4-555s21c1
Sequence:CCGGCGGGAACCAGACTTTCAACAACTCGAGTTGTTGAAAGTCTGGTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021542.4-1803s21c1
Sequence:CCGGCGAATACAACAAGGCAGATAACTCGAGTTATCTGCCTTGTTGTATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021542.4-2619s21c1
Sequence:CCGGCCGTCTCATTTCAGAGAGATTCTCGAGAATCTCTCTGAAATGAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021542.4-1358s21c1
Sequence:CCGGTGGCACCTTTGGTGGTCTATTCTCGAGAATAGACCACCAAAGGTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021542
VALIDATED
KCNK5 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070008    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021542.2-2620s1c1
Sequence:CCGGCCGTCTCATTTCAGAGAGATTCTCGAGAATCTCTCTGAAATGAGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021542.2-556s1c1
Sequence:CCGGCGGGAACCAGACTTTCAACAACTCGAGTTGTTGAAAGTCTGGTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021542.2-1240s1c1
Sequence:CCGGCCTCATCAAACAGATTGGGAACTCGAGTTCCCAATCTGTTTGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021542.2-1804s1c1
Sequence:CCGGCGAATACAACAAGGCAGATAACTCGAGTTATCTGCCTTGTTGTATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021542.2-989s1c1
Sequence:CCGGCACGCCCTATACCGATACTTTCTCGAGAAAGTATCGGTATAGGGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021542.4-581s21c1
Sequence:CCGGACTGGCCCAATGCAATGATTTCTCGAGAAATCATTGCATTGGGCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021542.4-555s21c1
Sequence:CCGGCGGGAACCAGACTTTCAACAACTCGAGTTGTTGAAAGTCTGGTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021542.4-1803s21c1
Sequence:CCGGCGAATACAACAAGGCAGATAACTCGAGTTATCTGCCTTGTTGTATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021542.4-2619s21c1
Sequence:CCGGCCGTCTCATTTCAGAGAGATTCTCGAGAATCTCTCTGAAATGAGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021542.4-1358s21c1
Sequence:CCGGTGGCACCTTTGGTGGTCTATTCTCGAGAATAGACCACCAAAGGTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003740
KCNK5 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003740.3-2256s21c1
Sequence:CCGGGTATTACTGAGCTCGGCATTTCTCGAGAAATGCCGAGCTCAGTAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003740.2-1794s1c1
Sequence:CCGGGCTGATGAATGAGTACAACAACTCGAGTTGTTGTACTCATTCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003740.2-1783s1c1
Sequence:CCGGCCTTACGAACAGCTGATGAATCTCGAGATTCATCAGCTGTTCGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003740.2-1201s1c1
Sequence:CCGGGTCAACATCTTCAGCTTTCTTCTCGAGAAGAAAGCTGAAGATGTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003740.2-570s1c1
Sequence:CCGGCCAGACCTTCAACAACTGGAACTCGAGTTCCAGTTGTTGAAGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003740.2-621s1c1
Sequence:CCGGCGTCATTACCACCATTGGATACTCGAGTATCCAATGGTGGTAATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003740.3-889s21c1
Sequence:CCGGGGTGATCCCACCCTTCGTATTCTCGAGAATACGAAGGGTGGGATCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003740
KCNK5 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003740.3-2256s21c1
Sequence:CCGGGTATTACTGAGCTCGGCATTTCTCGAGAAATGCCGAGCTCAGTAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003740.2-1794s1c1
Sequence:CCGGGCTGATGAATGAGTACAACAACTCGAGTTGTTGTACTCATTCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003740.2-1783s1c1
Sequence:CCGGCCTTACGAACAGCTGATGAATCTCGAGATTCATCAGCTGTTCGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003740.2-1201s1c1
Sequence:CCGGGTCAACATCTTCAGCTTTCTTCTCGAGAAGAAAGCTGAAGATGTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003740.2-570s1c1
Sequence:CCGGCCAGACCTTCAACAACTGGAACTCGAGTTCCAGTTGTTGAAGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003740.2-621s1c1
Sequence:CCGGCGTCATTACCACCATTGGATACTCGAGTATCCAATGGTGGTAATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003740.3-889s21c1
Sequence:CCGGGGTGATCCCACCCTTCGTATTCTCGAGAATACGAAGGGTGGGATCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003740
KCNK5 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003740.3-2256s21c1
Sequence:CCGGGTATTACTGAGCTCGGCATTTCTCGAGAAATGCCGAGCTCAGTAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003740.2-1794s1c1
Sequence:CCGGGCTGATGAATGAGTACAACAACTCGAGTTGTTGTACTCATTCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003740.2-1783s1c1
Sequence:CCGGCCTTACGAACAGCTGATGAATCTCGAGATTCATCAGCTGTTCGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003740.2-1201s1c1
Sequence:CCGGGTCAACATCTTCAGCTTTCTTCTCGAGAAGAAAGCTGAAGATGTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003740.2-570s1c1
Sequence:CCGGCCAGACCTTCAACAACTGGAACTCGAGTTCCAGTTGTTGAAGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003740.2-621s1c1
Sequence:CCGGCGTCATTACCACCATTGGATACTCGAGTATCCAATGGTGGTAATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003740.3-889s21c1
Sequence:CCGGGGTGATCCCACCCTTCGTATTCTCGAGAATACGAAGGGTGGGATCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)