EMAIL THIS PAGE TO A FRIEND

KCNK6

potassium channel, subfamily K, member 6

110 Gene Product Result for
Synonyms: K2p6.1 KCNK8 TOSS TWIK-2 TWIK2
UniProtKB ID: Q9Y257, Q9HB47
Gene ID:
Human(9424) Summary: This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. This channel protein, considered an open rectifier, is widely expressed. It is stimulated by arachidonic acid, and inhibited by internal acidification and volatile anaesthetics. [provided by RefSeq, Jul 2008]
Mouse(52150) potassium inwardly-rectifying channel, subfamily K, member 6
Rat(116491) potassium channel, subfamily K, member 6
Zebrafish(504083) potassium channel, subfamily K, member 6
cow(785418) potassium channel, subfamily K, member 6
domestic cat(101095938) potassium channel, subfamily K, member 6
dog(484531) potassium channel, subfamily K, member 6
domestic guinea pig(100379284) potassium inwardly-rectifying channel, subfamily K, member 6
naked mole-rat(101704019) potassium channel, subfamily K, member 6
sheep(101110698) potassium channel, subfamily K, member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_355877 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355877 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355877 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004823 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004823 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004823 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU195121 MISSION® esiRNA esiRNA targeting mouse Kcnk6 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004823 Rosetta Predictions human pricing
NM_053806 Rosetta Predictions rat pricing
NM_001033525 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221252 predicted 702
2 SASI_Hs01_00221253 predicted 798
3 SASI_Hs01_00221254 predicted 704
4 SASI_Hs01_00221255 predicted 378
5 SASI_Hs01_00221256 predicted 638
6 SASI_Hs01_00221257 predicted 412
7 SASI_Hs01_00221258 predicted 655
8 SASI_Hs01_00221259 predicted 644
9 SASI_Hs01_00221260 predicted 940
10 SASI_Hs01_00221261 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053806 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266623 predicted 1121
2 SASI_Rn02_00266624 predicted 1204
3 SASI_Rn02_00266625 predicted 1208
4 SASI_Rn02_00266626 predicted 1124
5 SASI_Rn02_00266627 predicted 1355
6 SASI_Rn02_00266628 predicted 1351
7 SASI_Rn01_00051687 predicted 1441
8 SASI_Rn02_00266629 predicted 1121
9 SASI_Rn02_00266630 predicted 983
10 SASI_Rn01_00051688 predicted 679
11 SASI_Rn01_00051689 predicted 867
12 SASI_Rn01_00051690 predicted 267
13 SASI_Rn01_00051691 predicted 278
14 SASI_Rn01_00051692 predicted 360
15 SASI_Rn01_00051693 predicted 598
16 SASI_Rn01_00051694 predicted 531
17 SASI_Rn01_00051695 predicted 882
18 SASI_Rn01_00051696 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288879 predicted 733
2 SASI_Mm02_00288880 predicted 896
3 SASI_Mm02_00288881 predicted 572
4 SASI_Mm02_00288882 predicted 721
5 SASI_Mm02_00288883 predicted 773
6 SASI_Mm02_00288884 predicted 431
7 SASI_Mm02_00288885 predicted 581
8 SASI_Mm02_00288886 predicted 733
9 SASI_Mm02_00288887 predicted 911
10 SASI_Mm02_00288888 predicted 879
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355877
KCNK6 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355877.1-579s1c1
Sequence:CCGGGTGGCTATATTCTTCCTGGTACTCGAGTACCAGGAAGAATATAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355877.1-647s1c1
Sequence:CCGGTGCTTTCTATTTCTGCTTCATCTCGAGATGAAGCAGAAATAGAAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355877.1-395s1c1
Sequence:CCGGCAAAGCCTTCTCCATCGTCTTCTCGAGAAGACGATGGAGAAGGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355877.1-429s1c1
Sequence:CCGGGTGCCTATCACCATGCTACTTCTCGAGAAGTAGCATGGTGATAGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355877.1-566s1c1
Sequence:CCGGGCTGATGGTCATAGTGGCTATCTCGAGATAGCCACTATGACCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355877
KCNK6 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355877.1-579s1c1
Sequence:CCGGGTGGCTATATTCTTCCTGGTACTCGAGTACCAGGAAGAATATAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355877.1-647s1c1
Sequence:CCGGTGCTTTCTATTTCTGCTTCATCTCGAGATGAAGCAGAAATAGAAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355877.1-395s1c1
Sequence:CCGGCAAAGCCTTCTCCATCGTCTTCTCGAGAAGACGATGGAGAAGGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355877.1-429s1c1
Sequence:CCGGGTGCCTATCACCATGCTACTTCTCGAGAAGTAGCATGGTGATAGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355877.1-566s1c1
Sequence:CCGGGCTGATGGTCATAGTGGCTATCTCGAGATAGCCACTATGACCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355877
KCNK6 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355877.1-579s1c1
Sequence:CCGGGTGGCTATATTCTTCCTGGTACTCGAGTACCAGGAAGAATATAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355877.1-647s1c1
Sequence:CCGGTGCTTTCTATTTCTGCTTCATCTCGAGATGAAGCAGAAATAGAAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355877.1-395s1c1
Sequence:CCGGCAAAGCCTTCTCCATCGTCTTCTCGAGAAGACGATGGAGAAGGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355877.1-429s1c1
Sequence:CCGGGTGCCTATCACCATGCTACTTCTCGAGAAGTAGCATGGTGATAGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355877.1-566s1c1
Sequence:CCGGGCTGATGGTCATAGTGGCTATCTCGAGATAGCCACTATGACCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004823
KCNK6 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 6
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004823.1-645s21c1
Sequence:CCGGGTCGTAGTGACCGTCTGCTTTCTCGAGAAAGCAGACGGTCACTACGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004823.1-936s1c1
Sequence:CCGGCCTGCCAGTTTCAATGCGGATCTCGAGATCCGCATTGAAACTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004823.1-1022s1c1
Sequence:CCGGCCACACCGACTACGCTTCCATCTCGAGATGGAAGCGTAGTCGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004823.1-710s1c1
Sequence:CCGGCTTCTTGGATGCCTTCTACTTCTCGAGAAGTAGAAGGCATCCAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004823.1-427s1c1
Sequence:CCGGCCGTGGGCTATGGGTACACAACTCGAGTTGTGTACCCATAGCCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004823.1-733s1c1
Sequence:CCGGGCTTTATCTCTCTGTCCACCACTCGAGTGGTGGACAGAGAGATAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004823
KCNK6 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 6
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004823.1-645s21c1
Sequence:CCGGGTCGTAGTGACCGTCTGCTTTCTCGAGAAAGCAGACGGTCACTACGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004823.1-936s1c1
Sequence:CCGGCCTGCCAGTTTCAATGCGGATCTCGAGATCCGCATTGAAACTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004823.1-1022s1c1
Sequence:CCGGCCACACCGACTACGCTTCCATCTCGAGATGGAAGCGTAGTCGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004823.1-710s1c1
Sequence:CCGGCTTCTTGGATGCCTTCTACTTCTCGAGAAGTAGAAGGCATCCAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004823.1-427s1c1
Sequence:CCGGCCGTGGGCTATGGGTACACAACTCGAGTTGTGTACCCATAGCCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004823.1-733s1c1
Sequence:CCGGGCTTTATCTCTCTGTCCACCACTCGAGTGGTGGACAGAGAGATAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004823
KCNK6 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 6
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004823.1-645s21c1
Sequence:CCGGGTCGTAGTGACCGTCTGCTTTCTCGAGAAAGCAGACGGTCACTACGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004823.1-936s1c1
Sequence:CCGGCCTGCCAGTTTCAATGCGGATCTCGAGATCCGCATTGAAACTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004823.1-1022s1c1
Sequence:CCGGCCACACCGACTACGCTTCCATCTCGAGATGGAAGCGTAGTCGGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004823.1-710s1c1
Sequence:CCGGCTTCTTGGATGCCTTCTACTTCTCGAGAAGTAGAAGGCATCCAAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004823.1-427s1c1
Sequence:CCGGCCGTGGGCTATGGGTACACAACTCGAGTTGTGTACCCATAGCCCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004823.1-733s1c1
Sequence:CCGGGCTTTATCTCTCTGTCCACCACTCGAGTGGTGGACAGAGAGATAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)