EMAIL THIS PAGE TO A FRIEND

KCNK7

potassium channel, subfamily K, member 7

132 Gene Product Result for
Synonyms: K2p7.1 TWIK3
UniProtKB ID: Q9Y2U2, Q3SYI2, Q9Y2U3, Q9Y2U4
Gene ID:
Human(10089) Summary: This gene encodes a member of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel; however, it may require other non-pore-forming proteins for activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16530) potassium channel, subfamily K, member 7
Rat(499303) potassium channel, subfamily K, member 7
sheep(101108703) potassium channel, subfamily K, member 7
domestic guinea pig(100379283) potassium channel, subfamily K, member 7
naked mole-rat(101719256) potassium channel, subfamily K, member 7
dog(483733) potassium channel, subfamily K, member 7
cow(532497) potassium channel, subfamily K, member 7
domestic cat(101096353) potassium channel, subfamily K, member 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005714 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005714 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005714 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004138 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004138 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004138 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005714 Rosetta Predictions human pricing
NM_033347 Rosetta Predictions human pricing
NM_033348 Rosetta Predictions human pricing
NM_033455 Rosetta Predictions human pricing
NM_033456 Rosetta Predictions human pricing
XM_574603 Rosetta Predictions rat pricing
XR_008731 Rosetta Predictions rat pricing
NM_001004138 Rosetta Predictions mouse pricing
NM_010609 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086800 predicted 239
2 SASI_Hs01_00086801 predicted 573
3 SASI_Hs01_00086802 predicted 358
4 SASI_Hs01_00086803 predicted 224
5 SASI_Hs01_00086804 predicted 506
6 SASI_Hs01_00086805 predicted 641
7 SASI_Hs01_00086806 predicted 461
8 SASI_Hs01_00086807 predicted 579
9 SASI_Hs01_00086808 predicted 1421
10 SASI_Hs01_00086809 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151859 predicted 239
2 SASI_Hs01_00151860 predicted 564
3 SASI_Hs01_00151861 predicted 358
4 SASI_Hs01_00151862 predicted 230
5 SASI_Hs01_00151863 predicted 503
6 SASI_Hs01_00151864 predicted 638
7 SASI_Hs01_00151865 predicted 459
8 SASI_Hs01_00151866 predicted 575
9 SASI_Hs01_00151867 predicted 1156
10 SASI_Hs01_00151868 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210279 predicted 247
2 SASI_Hs01_00210280 predicted 564
3 SASI_Hs01_00210281 predicted 361
4 SASI_Hs01_00210282 predicted 226
5 SASI_Hs01_00210283 predicted 502
6 SASI_Hs01_00210284 predicted 638
7 SASI_Hs01_00210285 predicted 462
8 SASI_Hs01_00210286 predicted 579
9 SASI_Hs01_00210287 predicted 1230
10 SASI_Hs01_00210288 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125454 predicted 244
2 SASI_Hs01_00125455 predicted 567
3 SASI_Hs01_00125456 predicted 359
4 SASI_Hs01_00125457 predicted 231
5 SASI_Hs01_00125458 predicted 503
6 SASI_Hs01_00125459 predicted 645
7 SASI_Hs01_00125460 predicted 458
8 SASI_Hs01_00125461 predicted 580
9 SASI_Hs01_00125462 predicted 1332
10 SASI_Hs01_00125463 predicted 1023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115395 predicted 252
2 SASI_Hs01_00115396 predicted 576
3 SASI_Hs01_00115397 predicted 362
4 SASI_Hs01_00115398 predicted 233
5 SASI_Hs01_00115399 predicted 517
6 SASI_Hs01_00115400 predicted 646
7 SASI_Hs01_00115401 predicted 464
8 SASI_Hs01_00115402 predicted 579
9 SASI_Hs01_00115403 predicted 1333
10 SASI_Hs01_00115404 predicted 1220
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00166659 predicted 636
2 SASI_Rn01_00166660 predicted 586
3 SASI_Rn01_00166661 predicted 594
4 SASI_Rn01_00166662 predicted 214
5 SASI_Rn01_00166663 predicted 708
6 SASI_Rn01_00166664 predicted 593
7 SASI_Rn01_00166665 predicted 688
8 SASI_Rn01_00166666 predicted 597
9 SASI_Rn01_00166667 predicted 273
10 SASI_Rn01_00166668 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00128303 predicted 733
2 SASI_Rn01_00128304 predicted 304
3 SASI_Rn01_00128305 predicted 688
4 SASI_Rn01_00128306 predicted 700
5 SASI_Rn01_00128307 predicted 318
6 SASI_Rn01_00128309 predicted 790
7 SASI_Rn01_00128310 predicted 907
8 SASI_Rn01_00128312 predicted 957
9 SASI_Rn02_00417772 predicted 281
10 SASI_Rn02_00417773 predicted 367
11 SASI_Rn01_00128308 predicted 872
12 SASI_Rn01_00128311 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004138 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035108 predicted 631
2 SASI_Mm01_00035109 predicted 587
3 SASI_Mm01_00035110 predicted 263
4 SASI_Mm01_00035111 predicted 206
5 SASI_Mm01_00035112 predicted 646
6 SASI_Mm01_00035113 predicted 603
7 SASI_Mm01_00035114 predicted 685
8 SASI_Mm01_00035115 predicted 280
9 SASI_Mm01_00035116 predicted 585
10 SASI_Mm01_00035117 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092046 predicted 625
2 SASI_Mm01_00092047 predicted 587
3 SASI_Mm01_00092048 predicted 268
4 SASI_Mm01_00092049 predicted 211
5 SASI_Mm01_00092050 predicted 643
6 SASI_Mm01_00092051 predicted 600
7 SASI_Mm01_00092052 predicted 692
8 SASI_Mm01_00092053 predicted 286
9 SASI_Mm01_00092054 predicted 591
10 SASI_Mm01_00092055 predicted 497
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005714
KCNK7 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005714.1-1346s21c1
Sequence:CCGGAGGATGAACTGGCTCTGAGCACTCGAGTGCTCAGAGCCAGTTCATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005714.1-1084s21c1
Sequence:CCGGCTCTGGTGGCAGCGTTGAGAACTCGAGTTCTCAACGCTGCCACCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005714.1-943s21c1
Sequence:CCGGGTAAGTCCAGCCACCTAACAGCTCGAGCTGTTAGGTGGCTGGACTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005714.1-834s21c1
Sequence:CCGGTACTTCTGCTTCAGCTCGCTCCTCGAGGAGCGAGCTGAAGCAGAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005714.1-931s1c1
Sequence:CCGGTCGCACTTCTTGGTAAGTCCACTCGAGTGGACTTACCAAGAAGTGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005714.1-908s1c1
Sequence:CCGGCGTGATTTACCACCTGGGCCACTCGAGTGGCCCAGGTGGTAAATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005714.1-366s1c1
Sequence:CCGGGCAGCCTTCCAGGCAGAGCATCTCGAGATGCTCTGCCTGGAAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005714.1-582s1c1
Sequence:CCGGGCCTTCTGCATGGTCTATGCACTCGAGTGCATAGACCATGCAGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005714
KCNK7 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005714.1-1346s21c1
Sequence:CCGGAGGATGAACTGGCTCTGAGCACTCGAGTGCTCAGAGCCAGTTCATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005714.1-1084s21c1
Sequence:CCGGCTCTGGTGGCAGCGTTGAGAACTCGAGTTCTCAACGCTGCCACCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005714.1-943s21c1
Sequence:CCGGGTAAGTCCAGCCACCTAACAGCTCGAGCTGTTAGGTGGCTGGACTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005714.1-834s21c1
Sequence:CCGGTACTTCTGCTTCAGCTCGCTCCTCGAGGAGCGAGCTGAAGCAGAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005714.1-931s1c1
Sequence:CCGGTCGCACTTCTTGGTAAGTCCACTCGAGTGGACTTACCAAGAAGTGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005714.1-908s1c1
Sequence:CCGGCGTGATTTACCACCTGGGCCACTCGAGTGGCCCAGGTGGTAAATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005714.1-366s1c1
Sequence:CCGGGCAGCCTTCCAGGCAGAGCATCTCGAGATGCTCTGCCTGGAAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005714.1-582s1c1
Sequence:CCGGGCCTTCTGCATGGTCTATGCACTCGAGTGCATAGACCATGCAGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005714
KCNK7 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005714.1-1346s21c1
Sequence:CCGGAGGATGAACTGGCTCTGAGCACTCGAGTGCTCAGAGCCAGTTCATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005714.1-1084s21c1
Sequence:CCGGCTCTGGTGGCAGCGTTGAGAACTCGAGTTCTCAACGCTGCCACCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005714.1-943s21c1
Sequence:CCGGGTAAGTCCAGCCACCTAACAGCTCGAGCTGTTAGGTGGCTGGACTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005714.1-834s21c1
Sequence:CCGGTACTTCTGCTTCAGCTCGCTCCTCGAGGAGCGAGCTGAAGCAGAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005714.1-931s1c1
Sequence:CCGGTCGCACTTCTTGGTAAGTCCACTCGAGTGGACTTACCAAGAAGTGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005714.1-908s1c1
Sequence:CCGGCGTGATTTACCACCTGGGCCACTCGAGTGGCCCAGGTGGTAAATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005714.1-366s1c1
Sequence:CCGGGCAGCCTTCCAGGCAGAGCATCTCGAGATGCTCTGCCTGGAAGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005714.1-582s1c1
Sequence:CCGGGCCTTCTGCATGGTCTATGCACTCGAGTGCATAGACCATGCAGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004138
KCNK7 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 7
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004138.1-593s21c1
Sequence:CCGGGCCTGCTAGAAGCCATCTACTCTCGAGAGTAGATGGCTTCTAGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004138.1-618s21c1
Sequence:CCGGTTTCGGCTCACTCAGCACGATCTCGAGATCGTGCTGAGTGAGCCGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004138.1-786s1c1
Sequence:CCGGCCGTGCCATGGTGAAATTCTTCTCGAGAAGAATTTCACCATGGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004138.1-743s1c1
Sequence:CCGGCCATGTTGTTAGCAGTAGAGACTCGAGTCTCTACTGCTAACAACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004138.1-336s1c1
Sequence:CCGGCCCACTCTCCTCAGGTGGAAACTCGAGTTTCCACCTGAGGAGAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004138.1-828s1c1
Sequence:CCGGCGATGAAGATCAAGATGGCATCTCGAGATGCCATCTTGATCTTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004138.1-129s1c1
Sequence:CCGGCCAGGCTGAACTGGCTAGCTTCTCGAGAAGCTAGCCAGTTCAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004138
KCNK7 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 7
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004138.1-593s21c1
Sequence:CCGGGCCTGCTAGAAGCCATCTACTCTCGAGAGTAGATGGCTTCTAGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004138.1-618s21c1
Sequence:CCGGTTTCGGCTCACTCAGCACGATCTCGAGATCGTGCTGAGTGAGCCGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004138.1-786s1c1
Sequence:CCGGCCGTGCCATGGTGAAATTCTTCTCGAGAAGAATTTCACCATGGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004138.1-743s1c1
Sequence:CCGGCCATGTTGTTAGCAGTAGAGACTCGAGTCTCTACTGCTAACAACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004138.1-336s1c1
Sequence:CCGGCCCACTCTCCTCAGGTGGAAACTCGAGTTTCCACCTGAGGAGAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004138.1-828s1c1
Sequence:CCGGCGATGAAGATCAAGATGGCATCTCGAGATGCCATCTTGATCTTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004138.1-129s1c1
Sequence:CCGGCCAGGCTGAACTGGCTAGCTTCTCGAGAAGCTAGCCAGTTCAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004138
KCNK7 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 7
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004138.1-593s21c1
Sequence:CCGGGCCTGCTAGAAGCCATCTACTCTCGAGAGTAGATGGCTTCTAGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004138.1-618s21c1
Sequence:CCGGTTTCGGCTCACTCAGCACGATCTCGAGATCGTGCTGAGTGAGCCGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004138.1-786s1c1
Sequence:CCGGCCGTGCCATGGTGAAATTCTTCTCGAGAAGAATTTCACCATGGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004138.1-743s1c1
Sequence:CCGGCCATGTTGTTAGCAGTAGAGACTCGAGTCTCTACTGCTAACAACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004138.1-336s1c1
Sequence:CCGGCCCACTCTCCTCAGGTGGAAACTCGAGTTTCCACCTGAGGAGAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004138.1-828s1c1
Sequence:CCGGCGATGAAGATCAAGATGGCATCTCGAGATGCCATCTTGATCTTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004138.1-129s1c1
Sequence:CCGGCCAGGCTGAACTGGCTAGCTTCTCGAGAAGCTAGCCAGTTCAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)