EMAIL THIS PAGE TO A FRIEND

KCNK9

potassium channel, subfamily K, member 9

63 Gene Product Result for
Synonyms: K2p9.1 KT3.2 TASK-3 TASK3
UniProtKB ID: Q9NPC2, Q2M290, Q540F2
Gene ID:
Human(51305) Summary: This gene encodes a member of the superfamily of potassium channel proteins containing two pore-forming P domains, and is highly expressed in the cerebellum. Amplification and overexpression of this gene has been observed in several types of human carcinomas, notably in breast cancer. This gene is imprinted in fetal brain, with preferential expression from the maternal allele. [provided by RefSeq, Oct 2010]
Mouse(223604) potassium channel, subfamily K, member 9
Rat(84429) potassium channel, subfamily K, member 9
chicken(428382) potassium channel, subfamily K, member 9
domestic cat(101084682) potassium channel, subfamily K, member 9
cow(539586) potassium channel, subfamily K, member 9
dog(482057) potassium channel, subfamily K, member 9
domestic guinea pig(100135568) potassium channel, subfamily K, member 9
naked mole-rat(101715849) potassium channel, subfamily K, member 9
sheep(101122116) potassium channel, subfamily K, member 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101225 Anti-KCNK9 antibody produced in rabbit affinity isolated antibody rat, guinea pig, rabbit, mouse, horse, human
immunohistochemistry, western blot pricing
P5247 Anti-Potassium Channel K2P9.1 (TASK3) antibody produced in rabbit affinity isolated antibody, lyophilized powder human, rat
western blot pricing
K0514 Monoclonal Anti-KCNK9 (TASK-3) antibody produced in mouse clone KCN-75, purified immunoglobulin, buffered aqueous solution human
ELISA, immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_139425 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_139425 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_139425 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016601 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016601 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016601 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007331 MISSION® esiRNA esiRNA targeting human KCNK9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016601 Rosetta Predictions human pricing
NM_053405 Rosetta Predictions rat pricing
NM_001033876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230311 predicted 1063
2 SASI_Hs02_00349729 predicted 1058
3 SASI_Hs01_00230314 predicted 816
4 SASI_Hs01_00230315 predicted 866
5 SASI_Hs01_00230316 predicted 717
6 SASI_Hs01_00230317 predicted 475
7 SASI_Hs01_00230318 predicted 331
8 SASI_Hs01_00230319 predicted 1053
9 SASI_Hs02_00349730 predicted 788
10 SASI_Hs02_00349731 predicted 782
11 SASI_Hs01_00230312 predicted 725
12 SASI_Hs01_00230313 predicted 537
13 SASI_Hs01_00230320 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106971 predicted 272
2 SASI_Rn02_00265913 predicted 351
3 SASI_Rn01_00106972 predicted 544
4 SASI_Rn01_00106974 predicted 403
5 SASI_Rn02_00265914 predicted 663
6 SASI_Rn01_00106976 predicted 258
7 SASI_Rn01_00106978 predicted 434
8 SASI_Rn01_00106979 predicted 592
9 SASI_Rn02_00265915 predicted 229
10 SASI_Rn02_00265916 predicted 345
11 SASI_Rn01_00106973 predicted 1339
12 SASI_Rn01_00106975 predicted 1311
13 SASI_Rn01_00106977 predicted 1311
14 SASI_Rn01_00106980 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076571 predicted 407
2 SASI_Mm01_00076572 predicted 660
3 SASI_Mm01_00076573 predicted 592
4 SASI_Mm01_00076574 predicted 273
5 SASI_Mm01_00076575 predicted 264
6 SASI_Mm01_00076576 predicted 552
7 SASI_Mm01_00076577 predicted 659
8 SASI_Mm01_00076578 predicted 435
9 SASI_Mm01_00076579 predicted 408
10 SASI_Mm01_00076580 predicted 223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_139425
KCNK9 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139425.3-84s1c1
Sequence:CCGGCCTTGAATACAAGGGAGACTTCTCGAGAAGTCTCCCTTGTATTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139425.3-1279s1c1
Sequence:CCGGCGTGAAAGTGATGATGCCCAACTCGAGTTGGGCATCATCACTTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139425.3-1567s1c1
Sequence:CCGGGAGGAGAAACTTAAAGCCGAACTCGAGTTCGGCTTTAAGTTTCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139425.3-1415s1c1
Sequence:CCGGGTCTGGTCCAACTTCCCTTTACTCGAGTAAAGGGAAGTTGGACCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139425.3-286s1c1
Sequence:CCGGGCAGTCTCCTTGGGAGTTATACTCGAGTATAACTCCCAAGGAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_139425
KCNK9 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139425.3-84s1c1
Sequence:CCGGCCTTGAATACAAGGGAGACTTCTCGAGAAGTCTCCCTTGTATTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139425.3-1279s1c1
Sequence:CCGGCGTGAAAGTGATGATGCCCAACTCGAGTTGGGCATCATCACTTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139425.3-1567s1c1
Sequence:CCGGGAGGAGAAACTTAAAGCCGAACTCGAGTTCGGCTTTAAGTTTCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139425.3-1415s1c1
Sequence:CCGGGTCTGGTCCAACTTCCCTTTACTCGAGTAAAGGGAAGTTGGACCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139425.3-286s1c1
Sequence:CCGGGCAGTCTCCTTGGGAGTTATACTCGAGTATAACTCCCAAGGAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_139425
KCNK9 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139425.3-84s1c1
Sequence:CCGGCCTTGAATACAAGGGAGACTTCTCGAGAAGTCTCCCTTGTATTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139425.3-1279s1c1
Sequence:CCGGCGTGAAAGTGATGATGCCCAACTCGAGTTGGGCATCATCACTTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139425.3-1567s1c1
Sequence:CCGGGAGGAGAAACTTAAAGCCGAACTCGAGTTCGGCTTTAAGTTTCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139425.3-1415s1c1
Sequence:CCGGGTCTGGTCCAACTTCCCTTTACTCGAGTAAAGGGAAGTTGGACCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_139425.3-286s1c1
Sequence:CCGGGCAGTCTCCTTGGGAGTTATACTCGAGTATAACTCCCAAGGAGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016601
KCNK9 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016601.2-1045s1c1
Sequence:CCGGCCACTCCATCTCTTACAAGATCTCGAGATCTTGTAAGAGATGGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016601.2-724s1c1
Sequence:CCGGCGTGGCCTTTAGCTTTATGTACTCGAGTACATAAAGCTAAAGGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016601.2-181s1c1
Sequence:CCGGGAAACTCAAAGCCGAGGAGATCTCGAGATCTCCTCGGCTTTGAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016601.2-1072s1c1
Sequence:CCGGGATCTCACCAAGCACATTAAACTCGAGTTTAATGTGCTTGGTGAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016601.2-645s21c1
Sequence:CCGCTCATCACGTTGACTACCATTGCTCGAGCAATGGTAGTCAACGTGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016601.2-1152s21c1
Sequence:CCGGACCACCAGAGGCTGATGAAACCTCGAGGTTTCATCAGCCTCTGGTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016601.2-1099s21c1
Sequence:CCGGCCTCTTCCCATCGCCTATTAGCTCGAGCTAATAGGCGATGGGAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016601
KCNK9 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016601.2-1045s1c1
Sequence:CCGGCCACTCCATCTCTTACAAGATCTCGAGATCTTGTAAGAGATGGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016601.2-724s1c1
Sequence:CCGGCGTGGCCTTTAGCTTTATGTACTCGAGTACATAAAGCTAAAGGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016601.2-181s1c1
Sequence:CCGGGAAACTCAAAGCCGAGGAGATCTCGAGATCTCCTCGGCTTTGAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016601.2-1072s1c1
Sequence:CCGGGATCTCACCAAGCACATTAAACTCGAGTTTAATGTGCTTGGTGAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016601.2-645s21c1
Sequence:CCGCTCATCACGTTGACTACCATTGCTCGAGCAATGGTAGTCAACGTGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016601.2-1152s21c1
Sequence:CCGGACCACCAGAGGCTGATGAAACCTCGAGGTTTCATCAGCCTCTGGTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016601.2-1099s21c1
Sequence:CCGGCCTCTTCCCATCGCCTATTAGCTCGAGCTAATAGGCGATGGGAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016601
KCNK9 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016601.2-1045s1c1
Sequence:CCGGCCACTCCATCTCTTACAAGATCTCGAGATCTTGTAAGAGATGGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016601.2-724s1c1
Sequence:CCGGCGTGGCCTTTAGCTTTATGTACTCGAGTACATAAAGCTAAAGGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016601.2-181s1c1
Sequence:CCGGGAAACTCAAAGCCGAGGAGATCTCGAGATCTCCTCGGCTTTGAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016601.2-1072s1c1
Sequence:CCGGGATCTCACCAAGCACATTAAACTCGAGTTTAATGTGCTTGGTGAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016601.2-645s21c1
Sequence:CCGCTCATCACGTTGACTACCATTGCTCGAGCAATGGTAGTCAACGTGATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016601.2-1152s21c1
Sequence:CCGGACCACCAGAGGCTGATGAAACCTCGAGGTTTCATCAGCCTCTGGTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016601.2-1099s21c1
Sequence:CCGGCCTCTTCCCATCGCCTATTAGCTCGAGCTAATAGGCGATGGGAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)