EMAIL THIS PAGE TO A FRIEND

KCNMA1

potassium large conductance calcium-activated channel, subfamily M, alpha member 1

360 Gene Product Result for
Synonyms: BKTM KCa1.1 MaxiK SAKCA SLO SLO-ALPHA SLO1 bA205K10.1 mSLO1
Gene ID:
Human(3778) Summary: MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(16531) potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Rat(83731) potassium large conductance calcium-activated channel, subfamily M, alpha member 1
chicken(374065) potassium large conductance calcium-activated channel, subfamily M, alpha member 1
cow(282573) potassium large conductance calcium-activated channel, subfamily M, alpha member 1
dog(403984) potassium large conductance calcium-activated channel, subfamily M, alpha member 1
domestic cat(101099080) potassium large conductance calcium-activated channel, subfamily M, alpha member 1
sheep(100270685) potassium large conductance calcium-activated channel, subfamily M, alpha member 1
domestic guinea pig(100728344) potassium large conductance calcium-activated channel, subfamily M, alpha member 1
naked mole-rat(101726007) potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101226 Anti-KCNMA1 antibody produced in rabbit affinity isolated antibody rabbit, pig, human, zebrafish, canine, sheep, bovine, rat, rabbit, horse, mouse, guinea pig
immunohistochemistry, western blot pricing
HPA054648 Anti-KCNMA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA057838 Anti-KCNMA1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
pricing
SAB2106413 Anti-KCNMA1 antibody produced in rabbit affinity isolated antibody mouse, bovine, pig, zebrafish, African clawed frog, rabbit, rat, canine, horse, human, guinea pig, rabbit, sheep
western blot pricing
SAB2900701 Anti-KCNMA1 antibody produced in rabbit affinity isolated antibody chicken, horse, rabbit, monkey, rat, zebrafish, human, mouse, pig, hamster, Xenopus, bovine
immunohistochemistry pricing
P8357 Anti-Potassium Channel BKCa (High-conductance Ca2+-activated K+ Channel, Maxi-K+, Slo, KCNMA1) antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, rat
western blot pricing
P4872 Anti-Potassium Channel KCa1.1, (BKCa) (1184-1200)(Large-conductance Ca2+-activated Potassium Channel) antibody produced in rabbit affinity isolated antibody, lyophilized powder human, rat, mouse
western blot pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
D9035 Diazoxide human, mouse, rat pricing
N170 NS 1619 powder mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002247 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002247 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002247 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073011 MISSION® esiRNA esiRNA human KCNMA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014797 Rosetta Predictions human pricing
NM_002247 Rosetta Predictions human pricing
NM_031828 Rosetta Predictions rat pricing
XM_579539 Rosetta Predictions rat pricing
NM_010610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106647 predicted 1796
2 SASI_Hs01_00106648 predicted 1072
3 SASI_Hs02_00306570 predicted 2641
4 SASI_Hs02_00306571 predicted 1195
5 SASI_Hs01_00106651 predicted 762
6 SASI_Hs01_00106652 predicted 1481
7 SASI_Hs01_00106653 predicted 1213
8 SASI_Hs01_00106654 predicted 3019
9 SASI_Hs02_00306572 predicted 3251
10 SASI_Hs02_00306573 predicted 1368
11 SASI_Hs01_00106646 predicted 1329
12 SASI_Hs01_00106649 predicted 2796
13 SASI_Hs01_00106650 predicted 749
14 SASI_Hs01_00106655 predicted 1594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002247 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156478 predicted 1798
2 SASI_Hs01_00156479 predicted 1075
3 SASI_Hs02_00333491 predicted 2629
4 SASI_Hs02_00333492 predicted 1189
5 SASI_Hs01_00156482 predicted 761
6 SASI_Hs01_00156483 predicted 1479
7 SASI_Hs01_00156484 predicted 1216
8 SASI_Hs01_00156485 predicted 3008
9 SASI_Hs02_00333493 predicted 3239
10 SASI_Hs02_00333494 predicted 1369
11 SASI_Hs01_00156477 predicted 1334
12 SASI_Hs01_00156480 predicted 2786
13 SASI_Hs01_00156481 predicted 753
14 SASI_Hs01_00156486 predicted 1589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094917 predicted 1645
2 SASI_Rn01_00094918 predicted 2060
3 SASI_Rn01_00094921 predicted 2199
4 SASI_Rn01_00094922 predicted 3536
5 SASI_Rn01_00094924 predicted 4211
6 SASI_Rn02_00265306 predicted 4285
7 SASI_Rn02_00265307 predicted 1512
8 SASI_Rn01_00094925 predicted 3646
9 SASI_Rn01_00094926 predicted 3894
10 SASI_Rn02_00265308 predicted 1187
11 SASI_Rn01_00094919 predicted 921
12 SASI_Rn01_00094920 predicted 3296
13 SASI_Rn01_00094923 predicted 2124
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00189651 predicted 2250
2 SASI_Rn01_00189652 predicted 2250
3 SASI_Rn01_00189653 predicted 2266
4 SASI_Rn01_00189654 predicted 2266
5 SASI_Rn01_00189655 predicted 2211
6 SASI_Rn01_00189656 predicted 2192
7 SASI_Rn01_00189657 predicted 2193
8 SASI_Rn01_00189658 predicted 221
9 SASI_Rn01_00189659 predicted 2199
10 SASI_Rn01_00189660 predicted 2263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189069 predicted 1224
2 SASI_Mm01_00189070 predicted 973
3 SASI_Mm01_00189071 predicted 1785
4 SASI_Mm01_00189072 predicted 3208
5 SASI_Mm01_00189073 predicted 641
6 SASI_Mm01_00189074 predicted 1301
7 SASI_Mm01_00189075 predicted 495
8 SASI_Mm01_00189076 predicted 3560
9 SASI_Mm01_00189077 predicted 2997
10 SASI_Mm01_00189078 predicted 772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010610
KCNMA1 MISSION shRNA Bacterial Glycerol Stock
potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010610.1-2691s1c1
Sequence:CCGGGCAGGCTAATTCCCAAGGATTCTCGAGAATCCTTGGGAATTAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010610.1-2950s1c1
Sequence:CCGGGCGACATACTTCAATGACAATCTCGAGATTGTCATTGAAGTATGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010610.1-376s1c1
Sequence:CCGGGCCCTCGTAATATACTTCATACTCGAGTATGAAGTATATTACGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010610.1-1350s1c1
Sequence:CCGGCCACCCAAAGATCAGGATCATCTCGAGATGATCCTGATCTTTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010610.1-957s1c1
Sequence:CCGGCCCTGAAATCATAGAGTTAATCTCGAGATTAACTCTATGATTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010610
KCNMA1 MISSION shRNA shRNA Plasmid DNA
potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010610.1-2691s1c1
Sequence:CCGGGCAGGCTAATTCCCAAGGATTCTCGAGAATCCTTGGGAATTAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010610.1-2950s1c1
Sequence:CCGGGCGACATACTTCAATGACAATCTCGAGATTGTCATTGAAGTATGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010610.1-376s1c1
Sequence:CCGGGCCCTCGTAATATACTTCATACTCGAGTATGAAGTATATTACGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010610.1-1350s1c1
Sequence:CCGGCCACCCAAAGATCAGGATCATCTCGAGATGATCCTGATCTTTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010610.1-957s1c1
Sequence:CCGGCCCTGAAATCATAGAGTTAATCTCGAGATTAACTCTATGATTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010610
KCNMA1 MISSION shRNA Lentiviral Transduction Particles
potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010610.1-2691s1c1
Sequence:CCGGGCAGGCTAATTCCCAAGGATTCTCGAGAATCCTTGGGAATTAGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010610.1-2950s1c1
Sequence:CCGGGCGACATACTTCAATGACAATCTCGAGATTGTCATTGAAGTATGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010610.1-376s1c1
Sequence:CCGGGCCCTCGTAATATACTTCATACTCGAGTATGAAGTATATTACGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010610.1-1350s1c1
Sequence:CCGGCCACCCAAAGATCAGGATCATCTCGAGATGATCCTGATCTTTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010610.1-957s1c1
Sequence:CCGGCCCTGAAATCATAGAGTTAATCTCGAGATTAACTCTATGATTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002247
KCNMA1 MISSION shRNA Bacterial Glycerol Stock
potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002247.x-5574s1c1
Sequence:CCGGGCGTAGTATTCAAACCAGTATCTCGAGATACTGGTTTGAATACTACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002247.x-780s1c1
Sequence:CCGGCCCAATAGAATCCTGCCAGAACTCGAGTTCTGGCAGGATTCTATTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002247.x-1612s1c1
Sequence:CCGGGTCAAGATAGAGTCAGCAGATCTCGAGATCTGCTGACTCTATCTTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002247.x-1789s1c1
Sequence:CCGGCCGAGCTGGAATTGGAAAGAACTCGAGTTCTTTCCAATTCCAGCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002247.x-1942s1c1
Sequence:CCGGTGGCAGAAATACTACTTGGAACTCGAGTTCCAAGTAGTATTTCTGCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002247
KCNMA1 MISSION shRNA shRNA Plasmid DNA
potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002247.x-5574s1c1
Sequence:CCGGGCGTAGTATTCAAACCAGTATCTCGAGATACTGGTTTGAATACTACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002247.x-780s1c1
Sequence:CCGGCCCAATAGAATCCTGCCAGAACTCGAGTTCTGGCAGGATTCTATTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002247.x-1612s1c1
Sequence:CCGGGTCAAGATAGAGTCAGCAGATCTCGAGATCTGCTGACTCTATCTTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002247.x-1789s1c1
Sequence:CCGGCCGAGCTGGAATTGGAAAGAACTCGAGTTCTTTCCAATTCCAGCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002247.x-1942s1c1
Sequence:CCGGTGGCAGAAATACTACTTGGAACTCGAGTTCCAAGTAGTATTTCTGCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002247
KCNMA1 MISSION shRNA Lentiviral Transduction Particles
potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002247.x-5574s1c1
Sequence:CCGGGCGTAGTATTCAAACCAGTATCTCGAGATACTGGTTTGAATACTACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002247.x-780s1c1
Sequence:CCGGCCCAATAGAATCCTGCCAGAACTCGAGTTCTGGCAGGATTCTATTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002247.x-1612s1c1
Sequence:CCGGGTCAAGATAGAGTCAGCAGATCTCGAGATCTGCTGACTCTATCTTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002247.x-1789s1c1
Sequence:CCGGCCGAGCTGGAATTGGAAAGAACTCGAGTTCTTTCCAATTCCAGCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002247.x-1942s1c1
Sequence:CCGGTGGCAGAAATACTACTTGGAACTCGAGTTCCAAGTAGTATTTCTGCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)