EMAIL THIS PAGE TO A FRIEND

KCNMB1

potassium large conductance calcium-activated channel, subfamily M, beta member 1

50 Gene Product Result for
Synonyms: BKbeta1 K(VCA)beta SLO-BETA hbeta1 hslo-beta k(VCA)beta-1 slo-beta-1
Gene ID:
Human(3779) Summary: MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the product of this gene, the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. [provided by RefSeq, Jul 2008]
Mouse(16533) potassium large conductance calcium-activated channel, subfamily M, beta member 1
Rat(29747) potassium large conductance calcium-activated channel, subfamily M, beta member 1
domestic guinea pig(100720445) potassium large conductance calcium-activated channel, subfamily M, beta member 1
naked mole-rat(101704020) potassium large conductance calcium-activated channel, subfamily M, beta member 1
sheep(100302624) potassium large conductance calcium-activated channel, subfamily M, beta member 1
Domestic Rabbit(100009034) potassium large conductance calcium-activated channel, subfamily M, beta member 1
chicken(395301) potassium large conductance calcium-activated channel, subfamily M, beta member 1
dog(403983) potassium large conductance calcium-activated channel, subfamily M, beta member 1
cow(407176) potassium large conductance calcium-activated channel, subfamily M, beta member 1
domestic cat(101096637) potassium large conductance calcium-activated channel, subfamily M, beta member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004137 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004137 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004137 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031169 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031169 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031169 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121151 MISSION® esiRNA esiRNA human KCNMB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004137 Rosetta Predictions human pricing
NM_019273 Rosetta Predictions rat pricing
NM_031169 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237659 predicted 444
2 SASI_Hs02_00336991 predicted 912
3 SASI_Hs01_00237660 predicted 1242
4 SASI_Hs01_00237661 predicted 528
5 SASI_Hs01_00237662 predicted 980
6 SASI_Hs01_00237663 predicted 1279
7 SASI_Hs01_00237664 predicted 1186
8 SASI_Hs01_00237665 predicted 559
9 SASI_Hs01_00237666 predicted 546
10 SASI_Hs01_00237668 predicted 992
11 SASI_Hs01_00237667 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039457 predicted 977
2 SASI_Rn01_00039458 predicted 938
3 SASI_Rn01_00039459 predicted 651
4 SASI_Rn01_00039460 predicted 986
5 SASI_Rn01_00039461 predicted 678
6 SASI_Rn01_00039462 predicted 563
7 SASI_Rn01_00039463 predicted 1037
8 SASI_Rn02_00262188 predicted 953
9 SASI_Rn01_00039464 predicted 814
10 SASI_Rn01_00039465 predicted 955
11 SASI_Rn01_00039466 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031169 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101136 predicted 211
2 SASI_Mm01_00101137 predicted 432
3 SASI_Mm02_00336995 predicted 196
4 SASI_Mm01_00101138 predicted 669
5 SASI_Mm01_00101139 predicted 203
6 SASI_Mm01_00101140 predicted 283
7 SASI_Mm01_00101142 predicted 687
8 SASI_Mm01_00101143 predicted 343
9 SASI_Mm01_00101144 predicted 224
10 SASI_Mm02_00336996 predicted 341
11 SASI_Mm01_00101141 predicted 315
12 SASI_Mm01_00101145 predicted 531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004137
KCNMB1 MISSION shRNA Bacterial Glycerol Stock
potassium large conductance calcium-activated channel, subfamily M, beta member 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004137.2-1255s21c1
Sequence:CCGGGTTTCCGGCTGCATCACTATGCTCGAGCATAGTGATGCAGCCGGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004137.2-823s1c1
Sequence:CCGGGAACGAAACCAGCGTCCTATTCTCGAGAATAGGACGCTGGTTTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004137.2-928s1c1
Sequence:CCGGCATGGTGAAGAGCAACCAGTACTCGAGTACTGGTTGCTCTTCACCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004137.2-444s1c1
Sequence:CCGGGAGCCCTTTGCCTGGGTGTAACTCGAGTTACACCCAGGCAAAGGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004137.2-559s1c1
Sequence:CCGGCCACCTGATTGAGACCAACATCTCGAGATGTTGGTCTCAATCAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004137.2-548s1c1
Sequence:CCGGGAATCCAAGTGCCACCTGATTCTCGAGAATCAGGTGGCACTTGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004137
KCNMB1 MISSION shRNA shRNA Plasmid DNA
potassium large conductance calcium-activated channel, subfamily M, beta member 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004137.2-1255s21c1
Sequence:CCGGGTTTCCGGCTGCATCACTATGCTCGAGCATAGTGATGCAGCCGGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004137.2-823s1c1
Sequence:CCGGGAACGAAACCAGCGTCCTATTCTCGAGAATAGGACGCTGGTTTCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004137.2-928s1c1
Sequence:CCGGCATGGTGAAGAGCAACCAGTACTCGAGTACTGGTTGCTCTTCACCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004137.2-444s1c1
Sequence:CCGGGAGCCCTTTGCCTGGGTGTAACTCGAGTTACACCCAGGCAAAGGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004137.2-559s1c1
Sequence:CCGGCCACCTGATTGAGACCAACATCTCGAGATGTTGGTCTCAATCAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004137.2-548s1c1
Sequence:CCGGGAATCCAAGTGCCACCTGATTCTCGAGAATCAGGTGGCACTTGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004137
KCNMB1 MISSION shRNA Lentiviral Transduction Particles
potassium large conductance calcium-activated channel, subfamily M, beta member 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004137.2-1255s21c1
Sequence:CCGGGTTTCCGGCTGCATCACTATGCTCGAGCATAGTGATGCAGCCGGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004137.2-823s1c1
Sequence:CCGGGAACGAAACCAGCGTCCTATTCTCGAGAATAGGACGCTGGTTTCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004137.2-928s1c1
Sequence:CCGGCATGGTGAAGAGCAACCAGTACTCGAGTACTGGTTGCTCTTCACCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004137.2-444s1c1
Sequence:CCGGGAGCCCTTTGCCTGGGTGTAACTCGAGTTACACCCAGGCAAAGGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004137.2-559s1c1
Sequence:CCGGCCACCTGATTGAGACCAACATCTCGAGATGTTGGTCTCAATCAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004137.2-548s1c1
Sequence:CCGGGAATCCAAGTGCCACCTGATTCTCGAGAATCAGGTGGCACTTGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031169
KCNMB1 MISSION shRNA Bacterial Glycerol Stock
potassium large conductance calcium-activated channel, subfamily M, beta member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031169.2-289s1c1
Sequence:CCGGCCATGCCTTTGGGTCAATGTACTCGAGTACATTGACCCAAAGGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031169.2-210s1c1
Sequence:CCGGCCAGGAATCCATATGTCACTTCTCGAGAAGTGACATATGGATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031169.2-599s1c1
Sequence:CCGGTGAAGCTCAACAGGTCCCTATCTCGAGATAGGGACCTGTTGAGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031169.2-344s1c1
Sequence:CCGGCGGAAGACACTCGGGATCAAACTCGAGTTTGATCCCGAGTGTCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031169.2-439s1c1
Sequence:CCGGGCCAATTTCTATAAGCACCATCTCGAGATGGTGCTTATAGAAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031169
KCNMB1 MISSION shRNA shRNA Plasmid DNA
potassium large conductance calcium-activated channel, subfamily M, beta member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031169.2-289s1c1
Sequence:CCGGCCATGCCTTTGGGTCAATGTACTCGAGTACATTGACCCAAAGGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031169.2-210s1c1
Sequence:CCGGCCAGGAATCCATATGTCACTTCTCGAGAAGTGACATATGGATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031169.2-599s1c1
Sequence:CCGGTGAAGCTCAACAGGTCCCTATCTCGAGATAGGGACCTGTTGAGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031169.2-344s1c1
Sequence:CCGGCGGAAGACACTCGGGATCAAACTCGAGTTTGATCCCGAGTGTCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031169.2-439s1c1
Sequence:CCGGGCCAATTTCTATAAGCACCATCTCGAGATGGTGCTTATAGAAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031169
KCNMB1 MISSION shRNA Lentiviral Transduction Particles
potassium large conductance calcium-activated channel, subfamily M, beta member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031169.2-289s1c1
Sequence:CCGGCCATGCCTTTGGGTCAATGTACTCGAGTACATTGACCCAAAGGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031169.2-210s1c1
Sequence:CCGGCCAGGAATCCATATGTCACTTCTCGAGAAGTGACATATGGATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031169.2-599s1c1
Sequence:CCGGTGAAGCTCAACAGGTCCCTATCTCGAGATAGGGACCTGTTGAGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031169.2-344s1c1
Sequence:CCGGCGGAAGACACTCGGGATCAAACTCGAGTTTGATCCCGAGTGTCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031169.2-439s1c1
Sequence:CCGGGCCAATTTCTATAAGCACCATCTCGAGATGGTGCTTATAGAAATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)