EMAIL THIS PAGE TO A FRIEND

KCNMB2

potassium large conductance calcium-activated channel, subfamily M, beta member 2

71 Gene Product Result for
UniProtKB ID: Q9Y691
Gene ID:
Human(10242) Summary: MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the modulatory beta subunit. The protein encoded by this gene is an auxiliary beta subunit which decreases the activation time of MaxiK alpha subunit currents. Alternative splicing results in multiple transcript variants of this gene. Additional variants are discussed in the literature, but their full length nature has not been described. [provided by RefSeq, Jul 2013]
Mouse(72413) potassium large conductance calcium-activated channel, subfamily M, beta member 2
Rat(294961) potassium large conductance calcium-activated channel, subfamily M, beta member 2
Zebrafish(541398) potassium large conductance calcium-activated channel, subfamily M, beta member 2
chicken(770907) potassium large conductance calcium-activated channel, subfamily M, beta member 2
dog(488179) potassium large conductance calcium-activated channel, subfamily M, beta member 2
cow(534568) potassium large conductance calcium-activated channel, subfamily M, beta member 2
domestic cat(101097911) potassium large conductance calcium-activated channel, subfamily M, beta member 2
sheep(100620053) potassium large conductance calcium-activated channel subfamily M beta member 2
domestic guinea pig(100723718) potassium large conductance calcium-activated channel, subfamily M, beta member 2
naked mole-rat(101709984) potassium large conductance calcium-activated channel, subfamily M, beta member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005832 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005832 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005832 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028231 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028231 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028231 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005832 Rosetta Predictions human pricing
NM_181361 Rosetta Predictions human pricing
NM_176861 Rosetta Predictions rat pricing
NM_028231 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182790 predicted 703
2 SASI_Hs01_00182791 predicted 929
3 SASI_Hs02_00340361 predicted 930
4 SASI_Hs01_00182792 predicted 871
5 SASI_Hs01_00182793 predicted 953
6 SASI_Hs01_00182794 predicted 426
7 SASI_Hs01_00182795 predicted 1118
8 SASI_Hs01_00182796 predicted 1094
9 SASI_Hs02_00340362 predicted 1097
10 SASI_Hs02_00340363 predicted 749
11 SASI_Hs01_00182797 predicted 460
12 SASI_Hs01_00182798 predicted 997
13 SASI_Hs01_00182799 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096684 predicted 755
2 SASI_Hs01_00096685 predicted 977
3 SASI_Hs02_00370028 predicted 970
4 SASI_Hs01_00096686 predicted 913
5 SASI_Hs01_00096687 predicted 994
6 SASI_Hs01_00096688 predicted 474
7 SASI_Hs01_00096689 predicted 1166
8 SASI_Hs01_00096690 predicted 1143
9 SASI_Hs02_00370029 predicted 1133
10 SASI_Hs02_00370030 predicted 800
11 SASI_Hs01_00096691 predicted 500
12 SASI_Hs01_00096692 predicted 1035
13 SASI_Hs01_00096693 predicted 931
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072117 predicted 416
2 SASI_Rn01_00072118 predicted 254
3 SASI_Rn02_00269577 predicted 260
4 SASI_Rn01_00072119 predicted 392
5 SASI_Rn01_00072121 predicted 211
6 SASI_Rn01_00072122 predicted 307
7 SASI_Rn01_00072123 predicted 398
8 SASI_Rn01_00072124 predicted 451
9 SASI_Rn02_00269578 predicted 320
10 SASI_Rn01_00072126 predicted 457
11 SASI_Rn01_00072120 predicted 257
12 SASI_Rn01_00072125 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028231 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195015 predicted 810
2 SASI_Mm01_00195016 predicted 900
3 SASI_Mm01_00195017 predicted 647
4 SASI_Mm01_00195018 predicted 935
5 SASI_Mm02_00333560 predicted 661
6 SASI_Mm01_00195020 predicted 1024
7 SASI_Mm02_00333561 predicted 980
8 SASI_Mm01_00195021 predicted 784
9 SASI_Mm01_00195023 predicted 1023
10 SASI_Mm02_00333562 predicted 646
11 SASI_Mm01_00195019 predicted 1189
12 SASI_Mm01_00195022 predicted 546
13 SASI_Mm01_00195024 predicted 957
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005832
KCNMB2 MISSION shRNA Bacterial Glycerol Stock
potassium large conductance calcium-activated channel, subfamily M, beta member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005832.3-636s21c1
Sequence:CCGGTGCCTCCAGGTGTACGTTAACCTCGAGGTTAACGTACACCTGGAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005832.3-1463s21c1
Sequence:CCGGGGACCAGATTTCCTAATTAAACTCGAGTTTAATTAGGAAATCTGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005832.3-990s21c1
Sequence:CCGGCAACGGATCAATAGATAAATGCTCGAGCATTTATCTATTGATCCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005832.3-564s1c1
Sequence:CCGGGCGTCCATCACGGAAACATTTCTCGAGAAATGTTTCCGTGATGGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005832.3-968s1c1
Sequence:CCGGCTCCCTACTATGTGAGAGGATCTCGAGATCCTCTCACATAGTAGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005832.3-713s1c1
Sequence:CCGGCAATCAGAAGTGCTCCTATATCTCGAGATATAGGAGCACTTCTGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005832.3-881s1c1
Sequence:CCGGCGTGCTGTTCCATTCACTCTTCTCGAGAAGAGTGAATGGAACAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005832.3-845s1c1
Sequence:CCGGGAAGAGTGTTATCCTAACAAACTCGAGTTTGTTAGGATAACACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005832
KCNMB2 MISSION shRNA shRNA Plasmid DNA
potassium large conductance calcium-activated channel, subfamily M, beta member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005832.3-636s21c1
Sequence:CCGGTGCCTCCAGGTGTACGTTAACCTCGAGGTTAACGTACACCTGGAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005832.3-1463s21c1
Sequence:CCGGGGACCAGATTTCCTAATTAAACTCGAGTTTAATTAGGAAATCTGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005832.3-990s21c1
Sequence:CCGGCAACGGATCAATAGATAAATGCTCGAGCATTTATCTATTGATCCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005832.3-564s1c1
Sequence:CCGGGCGTCCATCACGGAAACATTTCTCGAGAAATGTTTCCGTGATGGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005832.3-968s1c1
Sequence:CCGGCTCCCTACTATGTGAGAGGATCTCGAGATCCTCTCACATAGTAGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005832.3-713s1c1
Sequence:CCGGCAATCAGAAGTGCTCCTATATCTCGAGATATAGGAGCACTTCTGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005832.3-881s1c1
Sequence:CCGGCGTGCTGTTCCATTCACTCTTCTCGAGAAGAGTGAATGGAACAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005832.3-845s1c1
Sequence:CCGGGAAGAGTGTTATCCTAACAAACTCGAGTTTGTTAGGATAACACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005832
KCNMB2 MISSION shRNA Lentiviral Transduction Particles
potassium large conductance calcium-activated channel, subfamily M, beta member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005832.3-636s21c1
Sequence:CCGGTGCCTCCAGGTGTACGTTAACCTCGAGGTTAACGTACACCTGGAGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005832.3-1463s21c1
Sequence:CCGGGGACCAGATTTCCTAATTAAACTCGAGTTTAATTAGGAAATCTGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005832.3-990s21c1
Sequence:CCGGCAACGGATCAATAGATAAATGCTCGAGCATTTATCTATTGATCCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005832.3-564s1c1
Sequence:CCGGGCGTCCATCACGGAAACATTTCTCGAGAAATGTTTCCGTGATGGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005832.3-968s1c1
Sequence:CCGGCTCCCTACTATGTGAGAGGATCTCGAGATCCTCTCACATAGTAGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005832.3-713s1c1
Sequence:CCGGCAATCAGAAGTGCTCCTATATCTCGAGATATAGGAGCACTTCTGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005832.3-881s1c1
Sequence:CCGGCGTGCTGTTCCATTCACTCTTCTCGAGAAGAGTGAATGGAACAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005832.3-845s1c1
Sequence:CCGGGAAGAGTGTTATCCTAACAAACTCGAGTTTGTTAGGATAACACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028231
KCNMB2 MISSION shRNA Bacterial Glycerol Stock
potassium large conductance calcium-activated channel, subfamily M, beta member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028231.2-965s1c1
Sequence:CCGGGCTCCAATGTGCTGTTCCATTCTCGAGAATGGAACAGCACATTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028231.2-818s1c1
Sequence:CCGGCCTATATTCCTAAGTGTGGAACTCGAGTTCCACACTTAGGAATATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028231.2-1024s1c1
Sequence:CCGGGCAATCGTTGCTATGGTGAAACTCGAGTTTCACCATAGCAACGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028231.2-790s1c1
Sequence:CCGGGAGACCATGAAGATCAATCAACTCGAGTTGATTGATCTTCATGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028231.2-644s1c1
Sequence:CCGGCCCTGCTGAATGTGTCAATCACTCGAGTGATTGACACATTCAGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028231
KCNMB2 MISSION shRNA shRNA Plasmid DNA
potassium large conductance calcium-activated channel, subfamily M, beta member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028231.2-965s1c1
Sequence:CCGGGCTCCAATGTGCTGTTCCATTCTCGAGAATGGAACAGCACATTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028231.2-818s1c1
Sequence:CCGGCCTATATTCCTAAGTGTGGAACTCGAGTTCCACACTTAGGAATATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028231.2-1024s1c1
Sequence:CCGGGCAATCGTTGCTATGGTGAAACTCGAGTTTCACCATAGCAACGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028231.2-790s1c1
Sequence:CCGGGAGACCATGAAGATCAATCAACTCGAGTTGATTGATCTTCATGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028231.2-644s1c1
Sequence:CCGGCCCTGCTGAATGTGTCAATCACTCGAGTGATTGACACATTCAGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028231
KCNMB2 MISSION shRNA Lentiviral Transduction Particles
potassium large conductance calcium-activated channel, subfamily M, beta member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028231.2-965s1c1
Sequence:CCGGGCTCCAATGTGCTGTTCCATTCTCGAGAATGGAACAGCACATTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028231.2-818s1c1
Sequence:CCGGCCTATATTCCTAAGTGTGGAACTCGAGTTCCACACTTAGGAATATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028231.2-1024s1c1
Sequence:CCGGGCAATCGTTGCTATGGTGAAACTCGAGTTTCACCATAGCAACGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028231.2-790s1c1
Sequence:CCGGGAGACCATGAAGATCAATCAACTCGAGTTGATTGATCTTCATGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028231.2-644s1c1
Sequence:CCGGCCCTGCTGAATGTGTCAATCACTCGAGTGATTGACACATTCAGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)