EMAIL THIS PAGE TO A FRIEND

KCNMB3

potassium large conductance calcium-activated channel, subfamily M beta member 3

169 Gene Product Result for
Synonyms: BKBETA3 HBETA3 KCNMB2 KCNMBL SLOBETA3
Gene ID:
Human(27094) Summary: MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the modulatory beta subunit. The protein encoded by this gene is an auxiliary beta subunit which may partially inactivate or slightly decrease the activation time of MaxiK alpha subunit currents. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 22. [provided by RefSeq, Jul 2009]
Mouse(100502876) potassium large conductance calcium-activated channel, subfamily M, beta member 3
Rat(310303) potassium large conductance calcium-activated channel, subfamily M beta member 3
domestic guinea pig(100735360) potassium large conductance calcium-activated channel, subfamily M beta member 3
naked mole-rat(101712289) potassium large conductance calcium-activated channel, subfamily M beta member 3
sheep(101109757) potassium large conductance calcium-activated channel, subfamily M beta member 3
sheep(100620052) potassium large conductance calcium-activated channel, subfamily M beta member 3
cow(539609) potassium large conductance calcium-activated channel, subfamily M beta member 3
Horse(100065646) potassium large conductance calcium-activated channel, subfamily M beta member 3
domestic cat(101097167) potassium large conductance calcium-activated channel, subfamily M beta member 3
dog(488085) potassium large conductance calcium-activated channel, subfamily M beta member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014407 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114201 MISSION® esiRNA esiRNA human KCNMB3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014407 Rosetta Predictions human pricing
NM_171828 Rosetta Predictions human pricing
NM_171829 Rosetta Predictions human pricing
NM_171830 Rosetta Predictions human pricing
NM_001104560 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138894 predicted 915
2 SASI_Hs01_00138895 predicted 1186
3 SASI_Hs01_00138896 predicted 880
4 SASI_Hs01_00138897 predicted 1134
5 SASI_Hs01_00138898 predicted 1191
6 SASI_Hs01_00138899 predicted 1085
7 SASI_Hs01_00138900 predicted 978
8 SASI_Hs01_00138901 predicted 922
9 SASI_Hs01_00138902 predicted 1193
10 SASI_Hs01_00138903 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205018 predicted 736
2 SASI_Hs01_00205019 predicted 1004
3 SASI_Hs01_00205020 predicted 695
4 SASI_Hs01_00205021 predicted 954
5 SASI_Hs01_00205022 predicted 1019
6 SASI_Hs01_00205023 predicted 911
7 SASI_Hs01_00205024 predicted 800
8 SASI_Hs01_00205025 predicted 739
9 SASI_Hs01_00205026 predicted 1014
10 SASI_Hs01_00205027 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146306 predicted 1127
2 SASI_Hs01_00146307 predicted 1401
3 SASI_Hs01_00146308 predicted 1096
4 SASI_Hs01_00146309 predicted 1350
5 SASI_Hs01_00146310 predicted 1409
6 SASI_Hs01_00146311 predicted 1303
7 SASI_Hs01_00146312 predicted 1194
8 SASI_Hs01_00146313 predicted 1131
9 SASI_Hs01_00146314 predicted 1407
10 SASI_Hs01_00146315 predicted 1163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116130 predicted 1254
2 SASI_Hs01_00116131 predicted 1530
3 SASI_Hs01_00116132 predicted 1216
4 SASI_Hs01_00116133 predicted 1479
5 SASI_Hs01_00116134 predicted 1534
6 SASI_Hs01_00116135 predicted 1433
7 SASI_Hs01_00116136 predicted 1321
8 SASI_Hs01_00116137 predicted 1265
9 SASI_Hs01_00116138 predicted 1535
10 SASI_Hs01_00116139 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104560 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211656 predicted 539
2 SASI_Rn02_00211657 predicted 898
3 SASI_Rn02_00211658 predicted 919
4 SASI_Rn02_00211659 predicted 828
5 SASI_Rn02_00211660 predicted 1230
6 SASI_Rn02_00211661 predicted 1017
7 SASI_Rn02_00211662 predicted 1081
8 SASI_Rn02_00211663 predicted 640
9 SASI_Rn02_00211664 predicted 906
10 SASI_Rn02_00211665 predicted 1034
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014407
KCNMB3 MISSION shRNA Bacterial Glycerol Stock
potassium large conductance calcium-activated channel, subfamily M beta member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014407.3-956s1c1
Sequence:CCGGCCAGATAAATCCCAAGTGCTTCTCGAGAAGCACTTGGGATTTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014407.3-707s1c1
Sequence:CCGGGATGGGCTTCTCAGTCCTAATCTCGAGATTAGGACTGAGAAGCCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014407.3-991s1c1
Sequence:CCGGGCCACCAAGATAGAAATGATTCTCGAGAATCATTTCTATCTTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014407.3-1295s1c1
Sequence:CCGGGCATCAGTTCAAACTGTGCATCTCGAGATGCACAGTTTGAACTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014407.3-737s1c1
Sequence:CCGGGCTCGGAACAACCATTCTAAACTCGAGTTTAGAATGGTTGTTCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014407.3-880s21c1
Sequence:CCGGACCCGTGTCTTCAGGTGTTTGCTCGAGCAAACACCTGAAGACACGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014407.3-923s21c1
Sequence:CCGGGAAAGCTCTCCTACATTATAACTCGAGTTATAATGTAGGAGAGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014407.3-1348s21c1
Sequence:CCGGCTTAAGACGGTGGCCAAATTACTCGAGTAATTTGGCCACCGTCTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014407
KCNMB3 MISSION shRNA shRNA Plasmid DNA
potassium large conductance calcium-activated channel, subfamily M beta member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014407.3-956s1c1
Sequence:CCGGCCAGATAAATCCCAAGTGCTTCTCGAGAAGCACTTGGGATTTATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014407.3-707s1c1
Sequence:CCGGGATGGGCTTCTCAGTCCTAATCTCGAGATTAGGACTGAGAAGCCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014407.3-991s1c1
Sequence:CCGGGCCACCAAGATAGAAATGATTCTCGAGAATCATTTCTATCTTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014407.3-1295s1c1
Sequence:CCGGGCATCAGTTCAAACTGTGCATCTCGAGATGCACAGTTTGAACTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014407.3-737s1c1
Sequence:CCGGGCTCGGAACAACCATTCTAAACTCGAGTTTAGAATGGTTGTTCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014407.3-880s21c1
Sequence:CCGGACCCGTGTCTTCAGGTGTTTGCTCGAGCAAACACCTGAAGACACGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014407.3-923s21c1
Sequence:CCGGGAAAGCTCTCCTACATTATAACTCGAGTTATAATGTAGGAGAGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014407.3-1348s21c1
Sequence:CCGGCTTAAGACGGTGGCCAAATTACTCGAGTAATTTGGCCACCGTCTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014407
KCNMB3 MISSION shRNA Lentiviral Transduction Particles
potassium large conductance calcium-activated channel, subfamily M beta member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014407.3-956s1c1
Sequence:CCGGCCAGATAAATCCCAAGTGCTTCTCGAGAAGCACTTGGGATTTATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014407.3-707s1c1
Sequence:CCGGGATGGGCTTCTCAGTCCTAATCTCGAGATTAGGACTGAGAAGCCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014407.3-991s1c1
Sequence:CCGGGCCACCAAGATAGAAATGATTCTCGAGAATCATTTCTATCTTGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014407.3-1295s1c1
Sequence:CCGGGCATCAGTTCAAACTGTGCATCTCGAGATGCACAGTTTGAACTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014407.3-737s1c1
Sequence:CCGGGCTCGGAACAACCATTCTAAACTCGAGTTTAGAATGGTTGTTCCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014407.3-880s21c1
Sequence:CCGGACCCGTGTCTTCAGGTGTTTGCTCGAGCAAACACCTGAAGACACGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014407.3-923s21c1
Sequence:CCGGGAAAGCTCTCCTACATTATAACTCGAGTTATAATGTAGGAGAGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014407.3-1348s21c1
Sequence:CCGGCTTAAGACGGTGGCCAAATTACTCGAGTAATTTGGCCACCGTCTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)