EMAIL THIS PAGE TO A FRIEND

KCNMB4

potassium large conductance calcium-activated channel, subfamily M, beta member 4

74 Gene Product Result for
UniProtKB ID: Q86W47, Q8IVR3, Q9NPA4, Q9P0G5
Gene ID:
Human(27345) Summary: MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the modulatory beta subunit. The protein encoded by this gene is an auxiliary beta subunit which slows activation kinetics, leads to steeper calcium sensitivity, and shifts the voltage range of current activation to more negative potentials than does the beta 1 subunit. [provided by RefSeq, Jul 2008]
Mouse(58802) potassium large conductance calcium-activated channel, subfamily M, beta member 4
Rat(66016) potassium large conductance calcium-activated channel, subfamily M, beta member 4
chicken(417852) potassium large conductance calcium-activated channel, subfamily M, beta member 4
cow(520448) potassium large conductance calcium-activated channel, subfamily M, beta member 4
domestic cat(101101646) potassium large conductance calcium-activated channel, subfamily M, beta member 4
dog(474447) potassium large conductance calcium-activated channel, subfamily M, beta member 4
sheep(100620050) potassium large conductance calcium-activated channel, subfamily M, beta member 4
naked mole-rat(101721804) potassium large conductance calcium-activated channel, subfamily M, beta member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014505 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014505 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014505 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021452 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021452 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021452 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014505 Rosetta Predictions human pricing
NM_023960 Rosetta Predictions rat pricing
NM_021452 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054783 predicted 871
2 SASI_Hs01_00054784 predicted 785
3 SASI_Hs01_00054785 predicted 864
4 SASI_Hs01_00054786 predicted 643
5 SASI_Hs01_00054787 predicted 840
6 SASI_Hs01_00054788 predicted 1252
7 SASI_Hs01_00054789 predicted 1203
8 SASI_Hs02_00345764 predicted 850
9 SASI_Hs01_00054791 predicted 1002
10 SASI_Hs02_00345765 predicted 944
11 SASI_Hs01_00054782 predicted 715
12 SASI_Hs01_00054790 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057052 predicted 277
2 SASI_Rn01_00057053 predicted 356
3 SASI_Rn01_00057054 predicted 404
4 SASI_Rn01_00057055 predicted 441
5 SASI_Rn01_00057057 predicted 204
6 SASI_Rn01_00057058 predicted 616
7 SASI_Rn01_00057059 predicted 515
8 SASI_Rn02_00263767 predicted 481
9 SASI_Rn01_00057060 predicted 703
10 SASI_Rn01_00057061 predicted 550
11 SASI_Rn01_00057056 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041244 predicted 262
2 SASI_Mm01_00041245 predicted 342
3 SASI_Mm01_00041246 predicted 427
4 SASI_Mm01_00041247 predicted 488
5 SASI_Mm01_00041248 predicted 533
6 SASI_Mm01_00041249 predicted 604
7 SASI_Mm01_00041250 predicted 636
8 SASI_Mm01_00041251 predicted 464
9 SASI_Mm01_00041252 predicted 663
10 SASI_Mm01_00041253 predicted 237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014505
VALIDATED
KCNMB4 MISSION shRNA Bacterial Glycerol Stock
potassium large conductance calcium-activated channel, subfamily M, beta member 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014505.4-949s21c1
Sequence:CCGGGATGAGATTGTCCTCCTGCATCTCGAGATGCAGGAGGACAATCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014505.4-510s21c1
Sequence:CCGGGCTCGGCTTGTTTCTCATCATCTCGAGATGATGAGAAACAAGCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014505.4-792s21c1
Sequence:CCGGCTCCTATATCCCTCCCTGTAACTCGAGTTACAGGGAGGGATATAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014505.4-881s21c1
Sequence:CCGGCCCAGCCATTTACTTGCTATTCTCGAGAATAGCAAGTAAATGGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014505.4-717s21c1
Sequence:CCGGCGTGAACAACTCTGAGTCCAACTCGAGTTGGACTCAGAGTTGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014505.4-510s1c1
Sequence:CCGGGCTCGGCTTGTTTCTCATCATCTCGAGATGATGAGAAACAAGCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014505.4-792s1c1
Sequence:CCGGCTCCTATATCCCTCCCTGTAACTCGAGTTACAGGGAGGGATATAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014505.4-881s1c1
Sequence:CCGGCCCAGCCATTTACTTGCTATTCTCGAGAATAGCAAGTAAATGGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014505.4-949s1c1
Sequence:CCGGGATGAGATTGTCCTCCTGCATCTCGAGATGCAGGAGGACAATCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014505.4-717s1c1
Sequence:CCGGCGTGAACAACTCTGAGTCCAACTCGAGTTGGACTCAGAGTTGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014505
VALIDATED
KCNMB4 MISSION shRNA shRNA Plasmid DNA
potassium large conductance calcium-activated channel, subfamily M, beta member 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014505.4-949s21c1
Sequence:CCGGGATGAGATTGTCCTCCTGCATCTCGAGATGCAGGAGGACAATCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014505.4-510s21c1
Sequence:CCGGGCTCGGCTTGTTTCTCATCATCTCGAGATGATGAGAAACAAGCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014505.4-792s21c1
Sequence:CCGGCTCCTATATCCCTCCCTGTAACTCGAGTTACAGGGAGGGATATAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014505.4-881s21c1
Sequence:CCGGCCCAGCCATTTACTTGCTATTCTCGAGAATAGCAAGTAAATGGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014505.4-717s21c1
Sequence:CCGGCGTGAACAACTCTGAGTCCAACTCGAGTTGGACTCAGAGTTGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014505.4-510s1c1
Sequence:CCGGGCTCGGCTTGTTTCTCATCATCTCGAGATGATGAGAAACAAGCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014505.4-792s1c1
Sequence:CCGGCTCCTATATCCCTCCCTGTAACTCGAGTTACAGGGAGGGATATAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014505.4-881s1c1
Sequence:CCGGCCCAGCCATTTACTTGCTATTCTCGAGAATAGCAAGTAAATGGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014505.4-949s1c1
Sequence:CCGGGATGAGATTGTCCTCCTGCATCTCGAGATGCAGGAGGACAATCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014505.4-717s1c1
Sequence:CCGGCGTGAACAACTCTGAGTCCAACTCGAGTTGGACTCAGAGTTGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014505
VALIDATED
KCNMB4 MISSION shRNA Lentiviral Transduction Particles
potassium large conductance calcium-activated channel, subfamily M, beta member 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014505.4-949s21c1
Sequence:CCGGGATGAGATTGTCCTCCTGCATCTCGAGATGCAGGAGGACAATCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014505.4-510s21c1
Sequence:CCGGGCTCGGCTTGTTTCTCATCATCTCGAGATGATGAGAAACAAGCCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014505.4-792s21c1
Sequence:CCGGCTCCTATATCCCTCCCTGTAACTCGAGTTACAGGGAGGGATATAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014505.4-881s21c1
Sequence:CCGGCCCAGCCATTTACTTGCTATTCTCGAGAATAGCAAGTAAATGGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014505.4-717s21c1
Sequence:CCGGCGTGAACAACTCTGAGTCCAACTCGAGTTGGACTCAGAGTTGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014505.4-510s1c1
Sequence:CCGGGCTCGGCTTGTTTCTCATCATCTCGAGATGATGAGAAACAAGCCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014505.4-792s1c1
Sequence:CCGGCTCCTATATCCCTCCCTGTAACTCGAGTTACAGGGAGGGATATAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014505.4-881s1c1
Sequence:CCGGCCCAGCCATTTACTTGCTATTCTCGAGAATAGCAAGTAAATGGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014505.4-949s1c1
Sequence:CCGGGATGAGATTGTCCTCCTGCATCTCGAGATGCAGGAGGACAATCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014505.4-717s1c1
Sequence:CCGGCGTGAACAACTCTGAGTCCAACTCGAGTTGGACTCAGAGTTGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021452
KCNMB4 MISSION shRNA Bacterial Glycerol Stock
potassium large conductance calcium-activated channel, subfamily M, beta member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021452.1-431s1c1
Sequence:CCGGCCAGCCATTCACTTGCTATTTCTCGAGAAATAGCAAGTGAATGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021452.1-126s1c1
Sequence:CCGGCCCGCCTTGCAGGATCTGCAACTCGAGTTGCAGATCCTGCAAGGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021452.1-608s1c1
Sequence:CCGGAGCCATGAAGAAACGCAAGTTCTCGAGAACTTGCGTTTCTTCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021452.1-399s1c1
Sequence:CCGGTGGCAGCAGTATTGGAAAGATCTCGAGATCTTTCCAATACTGCTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021452.1-266s1c1
Sequence:CCGGCGTGAACAACTCCGAGTCCAACTCGAGTTGGACTCGGAGTTGTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021452
KCNMB4 MISSION shRNA shRNA Plasmid DNA
potassium large conductance calcium-activated channel, subfamily M, beta member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021452.1-431s1c1
Sequence:CCGGCCAGCCATTCACTTGCTATTTCTCGAGAAATAGCAAGTGAATGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021452.1-126s1c1
Sequence:CCGGCCCGCCTTGCAGGATCTGCAACTCGAGTTGCAGATCCTGCAAGGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021452.1-608s1c1
Sequence:CCGGAGCCATGAAGAAACGCAAGTTCTCGAGAACTTGCGTTTCTTCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021452.1-399s1c1
Sequence:CCGGTGGCAGCAGTATTGGAAAGATCTCGAGATCTTTCCAATACTGCTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021452.1-266s1c1
Sequence:CCGGCGTGAACAACTCCGAGTCCAACTCGAGTTGGACTCGGAGTTGTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021452
KCNMB4 MISSION shRNA Lentiviral Transduction Particles
potassium large conductance calcium-activated channel, subfamily M, beta member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021452.1-431s1c1
Sequence:CCGGCCAGCCATTCACTTGCTATTTCTCGAGAAATAGCAAGTGAATGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021452.1-126s1c1
Sequence:CCGGCCCGCCTTGCAGGATCTGCAACTCGAGTTGCAGATCCTGCAAGGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021452.1-608s1c1
Sequence:CCGGAGCCATGAAGAAACGCAAGTTCTCGAGAACTTGCGTTTCTTCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021452.1-399s1c1
Sequence:CCGGTGGCAGCAGTATTGGAAAGATCTCGAGATCTTTCCAATACTGCTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021452.1-266s1c1
Sequence:CCGGCGTGAACAACTCCGAGTCCAACTCGAGTTGGACTCGGAGTTGTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)