EMAIL THIS PAGE TO A FRIEND

KCNN1

potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1

81 Gene Product Result for
Synonyms: KCa2.1 SK1 SKCA1 hSK1
UniProtKB ID: Q92952, Q5KR10, Q6DJU4
Gene ID:
Human(3780) Summary: Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. This gene is a member of the KCNN family of potassium channel genes. [provided by RefSeq, Jul 2008]
Mouse(84036) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
Rat(54261) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
domestic guinea pig(100715012) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
naked mole-rat(101717556) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
sheep(101112056) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
dog(484829) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
cow(408008) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
domestic cat(101085608) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
A1289 Apamin from bee venom, ≥95% (HPLC) rat pricing
A9459 Apamin synthetic, ≥97% (HPLC) rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002248 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002248 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002248 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_032397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_032397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_032397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024131 MISSION® esiRNA esiRNA human KCNN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002248 Rosetta Predictions human pricing
NM_019313 Rosetta Predictions rat pricing
NM_032397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030339 predicted 648
2 SASI_Hs01_00030340 predicted 713
3 SASI_Hs02_00333495 predicted 1269
4 SASI_Hs01_00030342 predicted 2352
5 SASI_Hs02_00333496 predicted 2338
6 SASI_Hs02_00333497 predicted 711
7 SASI_Hs01_00030343 predicted 762
8 SASI_Hs01_00030345 predicted 600
9 SASI_Hs01_00030347 predicted 797
10 SASI_Hs01_00030348 predicted 2419
11 SASI_Hs01_00030341 predicted 1601
12 SASI_Hs01_00030344 predicted 1127
13 SASI_Hs01_00030346 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019313 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051534 predicted 1228
2 SASI_Rn01_00051535 predicted 1281
3 SASI_Rn01_00051536 predicted 652
4 SASI_Rn01_00051537 predicted 275
5 SASI_Rn01_00051538 predicted 538
6 SASI_Rn02_00262279 predicted 1168
7 SASI_Rn01_00051540 predicted 305
8 SASI_Rn01_00051541 predicted 1259
9 SASI_Rn01_00051542 predicted 1142
10 SASI_Rn02_00262280 predicted 1274
11 SASI_Rn01_00051539 predicted 304
12 SASI_Rn01_00051543 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064194 predicted 1450
2 SASI_Mm01_00064195 predicted 2129
3 SASI_Mm01_00064202 predicted 2257
4 SASI_Mm01_00064196 predicted 2104
5 SASI_Mm01_00064197 predicted 1086
6 SASI_Mm01_00064198 predicted 1418
7 SASI_Mm02_00337242 predicted 2182
8 SASI_Mm02_00337243 predicted 2250
9 SASI_Mm01_00064201 predicted 2125
10 SASI_Mm01_00064203 predicted 2118
11 SASI_Mm01_00064199 predicted 2276
12 SASI_Mm01_00064200 predicted 2299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002248
KCNN1 MISSION shRNA Bacterial Glycerol Stock
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002248.3-1568s21c1
Sequence:CCGGGTTCGGAAACACCAGCGTAAGCTCGAGCTTACGCTGGTGTTTCCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002248.3-1114s21c1
Sequence:CCGGCAACACGCGCTTCGTCATGAACTCGAGTTCATGACGAAGCGCGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002248.3-1653s21c1
Sequence:CCGGACGACCAGGCTAACACGCTTACTCGAGTAAGCGTGTTAGCCTGGTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002248.3-2361s1c1
Sequence:CCGGGCCTAGAATCCTAGCCTAGAACTCGAGTTCTAGGCTAGGATTCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002248.3-1040s1c1
Sequence:CCGGGTGATGCTACTGCACAGCAAACTCGAGTTTGCTGTGCAGTAGCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002248.3-627s1c1
Sequence:CCGGTCAGCGACTATGCCCTCATTTCTCGAGAAATGAGGGCATAGTCGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002248.3-1695s1c1
Sequence:CCGGCCGTCATGTACGACCTTGTATCTCGAGATACAAGGTCGTACATGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002248.3-708s1c1
Sequence:CCGGCCAAGGAGTCTCTGTACTCATCTCGAGATGAGTACAGAGACTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002248
KCNN1 MISSION shRNA shRNA Plasmid DNA
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002248.3-1568s21c1
Sequence:CCGGGTTCGGAAACACCAGCGTAAGCTCGAGCTTACGCTGGTGTTTCCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002248.3-1114s21c1
Sequence:CCGGCAACACGCGCTTCGTCATGAACTCGAGTTCATGACGAAGCGCGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002248.3-1653s21c1
Sequence:CCGGACGACCAGGCTAACACGCTTACTCGAGTAAGCGTGTTAGCCTGGTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002248.3-2361s1c1
Sequence:CCGGGCCTAGAATCCTAGCCTAGAACTCGAGTTCTAGGCTAGGATTCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002248.3-1040s1c1
Sequence:CCGGGTGATGCTACTGCACAGCAAACTCGAGTTTGCTGTGCAGTAGCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002248.3-627s1c1
Sequence:CCGGTCAGCGACTATGCCCTCATTTCTCGAGAAATGAGGGCATAGTCGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002248.3-1695s1c1
Sequence:CCGGCCGTCATGTACGACCTTGTATCTCGAGATACAAGGTCGTACATGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002248.3-708s1c1
Sequence:CCGGCCAAGGAGTCTCTGTACTCATCTCGAGATGAGTACAGAGACTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002248
KCNN1 MISSION shRNA Lentiviral Transduction Particles
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002248.3-1568s21c1
Sequence:CCGGGTTCGGAAACACCAGCGTAAGCTCGAGCTTACGCTGGTGTTTCCGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002248.3-1114s21c1
Sequence:CCGGCAACACGCGCTTCGTCATGAACTCGAGTTCATGACGAAGCGCGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002248.3-1653s21c1
Sequence:CCGGACGACCAGGCTAACACGCTTACTCGAGTAAGCGTGTTAGCCTGGTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002248.3-2361s1c1
Sequence:CCGGGCCTAGAATCCTAGCCTAGAACTCGAGTTCTAGGCTAGGATTCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002248.3-1040s1c1
Sequence:CCGGGTGATGCTACTGCACAGCAAACTCGAGTTTGCTGTGCAGTAGCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002248.3-627s1c1
Sequence:CCGGTCAGCGACTATGCCCTCATTTCTCGAGAAATGAGGGCATAGTCGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002248.3-1695s1c1
Sequence:CCGGCCGTCATGTACGACCTTGTATCTCGAGATACAAGGTCGTACATGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002248.3-708s1c1
Sequence:CCGGCCAAGGAGTCTCTGTACTCATCTCGAGATGAGTACAGAGACTCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032397
KCNN1 MISSION shRNA Bacterial Glycerol Stock
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032397.1-628s1c1
Sequence:CCGGACTGTCATCTTGCTTGGCCTTCTCGAGAAGGCCAAGCAAGATGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032397.1-2010s1c1
Sequence:CCGGGCCTCAACATTTCTAAGTAAACTCGAGTTTACTTAGAAATGTTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032397.1-1682s1c1
Sequence:CCGGGCCTTATAGCCCAAGCCATATCTCGAGATATGGCTTGGGCTATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032397.1-508s1c1
Sequence:CCGGGCGCTCATCTTTGGCATGTTTCTCGAGAAACATGCCAAAGATGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032397.1-1288s1c1
Sequence:CCGGGAACTCACCAAGGCTGAGAAACTCGAGTTTCTCAGCCTTGGTGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032397
KCNN1 MISSION shRNA shRNA Plasmid DNA
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032397.1-628s1c1
Sequence:CCGGACTGTCATCTTGCTTGGCCTTCTCGAGAAGGCCAAGCAAGATGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032397.1-2010s1c1
Sequence:CCGGGCCTCAACATTTCTAAGTAAACTCGAGTTTACTTAGAAATGTTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032397.1-1682s1c1
Sequence:CCGGGCCTTATAGCCCAAGCCATATCTCGAGATATGGCTTGGGCTATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032397.1-508s1c1
Sequence:CCGGGCGCTCATCTTTGGCATGTTTCTCGAGAAACATGCCAAAGATGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032397.1-1288s1c1
Sequence:CCGGGAACTCACCAAGGCTGAGAAACTCGAGTTTCTCAGCCTTGGTGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032397
KCNN1 MISSION shRNA Lentiviral Transduction Particles
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032397.1-628s1c1
Sequence:CCGGACTGTCATCTTGCTTGGCCTTCTCGAGAAGGCCAAGCAAGATGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032397.1-2010s1c1
Sequence:CCGGGCCTCAACATTTCTAAGTAAACTCGAGTTTACTTAGAAATGTTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032397.1-1682s1c1
Sequence:CCGGGCCTTATAGCCCAAGCCATATCTCGAGATATGGCTTGGGCTATAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032397.1-508s1c1
Sequence:CCGGGCGCTCATCTTTGGCATGTTTCTCGAGAAACATGCCAAAGATGAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032397.1-1288s1c1
Sequence:CCGGGAACTCACCAAGGCTGAGAAACTCGAGTTTCTCAGCCTTGGTGAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)