EMAIL THIS PAGE TO A FRIEND

KCNN2

potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2

84 Gene Product Result for
Synonyms: KCa2.2 SK2 SKCA2 SKCa 2 hSK2
UniProtKB ID: Q9H2S1, A6NF94, Q0VFZ4, Q6PJI0
Gene ID:
Human(3781) Summary: Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene is a member of the KCNN family of potassium channel genes. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(140492) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
Rat(54262) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
chicken(395579) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
cow(404177) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
domestic cat(101099926) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
dog(474640) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
sheep(101105660) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
domestic guinea pig(100734732) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
naked mole-rat(101725711) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021614 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021614 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021614 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021614 Rosetta Predictions human pricing
NM_170775 Rosetta Predictions human pricing
NM_019314 Rosetta Predictions rat pricing
NM_080465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021614 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170393 predicted 2096
2 SASI_Hs01_00170394 predicted 1909
3 SASI_Hs01_00170395 predicted 1718
4 SASI_Hs01_00170396 predicted 1924
5 SASI_Hs01_00170397 predicted 1831
6 SASI_Hs01_00170398 predicted 1904
7 SASI_Hs01_00170399 predicted 1874
8 SASI_Hs01_00170401 predicted 1736
9 SASI_Hs01_00170402 predicted 1817
10 SASI_Hs02_00354948 predicted 1861
11 SASI_Hs01_00170400 predicted 1998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166556 predicted 1033
2 SASI_Hs01_00166557 predicted 854
3 SASI_Hs01_00166558 predicted 666
4 SASI_Hs01_00166559 predicted 866
5 SASI_Hs01_00166560 predicted 770
6 SASI_Hs01_00166561 predicted 840
7 SASI_Hs01_00166562 predicted 819
8 SASI_Hs01_00166564 predicted 674
9 SASI_Hs01_00166565 predicted 758
10 SASI_Hs02_00367747 predicted 801
11 SASI_Hs01_00166563 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019314 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089511 predicted 1183
2 SASI_Rn01_00089512 predicted 1361
3 SASI_Rn01_00089513 predicted 1215
4 SASI_Rn01_00089514 predicted 777
5 SASI_Rn01_00089515 predicted 1128
6 SASI_Rn01_00089516 predicted 660
7 SASI_Rn01_00089517 predicted 903
8 SASI_Rn01_00089518 predicted 1441
9 SASI_Rn01_00089519 predicted 1286
10 SASI_Rn01_00089520 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089267 predicted 1202
2 SASI_Mm01_00089268 predicted 1528
3 SASI_Mm01_00089269 predicted 1343
4 SASI_Mm01_00089270 predicted 1031
5 SASI_Mm01_00089271 predicted 514
6 SASI_Mm02_00338134 predicted 880
7 SASI_Mm01_00089273 predicted 1428
8 SASI_Mm01_00089274 predicted 1268
9 SASI_Mm01_00089275 predicted 1118
10 SASI_Mm02_00338135 predicted 1338
11 SASI_Mm01_00089266 predicted 1353
12 SASI_Mm01_00089272 predicted 767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021614
KCNN2 MISSION shRNA Bacterial Glycerol Stock
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021614.2-1079s1c1
Sequence:CCGGGCCATGACTTATGAGCGTATTCTCGAGAATACGCTCATAAGTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021614.2-670s1c1
Sequence:CCGGCGAGCACAACAACTCCAACAACTCGAGTTGTTGGAGTTGTTGTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021614.2-1912s1c1
Sequence:CCGGCCAGAACATCATGTATGATATCTCGAGATATCATACATGATGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021614.2-1238s1c1
Sequence:CCGGCCAATGTTCTTAAGACTCTATCTCGAGATAGAGTCTTAAGAACATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021614.2-1725s1c1
Sequence:CCGGCTGCCAATGTACTCAGGGAAACTCGAGTTTCCCTGAGTACATTGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021614.2-2192s21c1
Sequence:CCGGAGCTAGAAGAGAATAAGTTAACTCGAGTTAACTTATTCTCTTCTAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021614.2-1209s21c1
Sequence:CCGGCCGCTGATGTGGATATTATTTCTCGAGAAATAATATCCACATCAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021614.2-1499s21c1
Sequence:CCGGGCGATGTGGTTGATATCAATACTCGAGTATTGATATCAACCACATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021614.2-2274s21c1
Sequence:CCGGTATGGTTCTAATCAGCGTTATCTCGAGATAACGCTGATTAGAACCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021614
KCNN2 MISSION shRNA shRNA Plasmid DNA
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021614.2-1079s1c1
Sequence:CCGGGCCATGACTTATGAGCGTATTCTCGAGAATACGCTCATAAGTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021614.2-670s1c1
Sequence:CCGGCGAGCACAACAACTCCAACAACTCGAGTTGTTGGAGTTGTTGTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021614.2-1912s1c1
Sequence:CCGGCCAGAACATCATGTATGATATCTCGAGATATCATACATGATGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021614.2-1238s1c1
Sequence:CCGGCCAATGTTCTTAAGACTCTATCTCGAGATAGAGTCTTAAGAACATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021614.2-1725s1c1
Sequence:CCGGCTGCCAATGTACTCAGGGAAACTCGAGTTTCCCTGAGTACATTGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021614.2-2192s21c1
Sequence:CCGGAGCTAGAAGAGAATAAGTTAACTCGAGTTAACTTATTCTCTTCTAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021614.2-1209s21c1
Sequence:CCGGCCGCTGATGTGGATATTATTTCTCGAGAAATAATATCCACATCAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021614.2-1499s21c1
Sequence:CCGGGCGATGTGGTTGATATCAATACTCGAGTATTGATATCAACCACATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021614.2-2274s21c1
Sequence:CCGGTATGGTTCTAATCAGCGTTATCTCGAGATAACGCTGATTAGAACCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021614
KCNN2 MISSION shRNA Lentiviral Transduction Particles
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021614.2-1079s1c1
Sequence:CCGGGCCATGACTTATGAGCGTATTCTCGAGAATACGCTCATAAGTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021614.2-670s1c1
Sequence:CCGGCGAGCACAACAACTCCAACAACTCGAGTTGTTGGAGTTGTTGTGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021614.2-1912s1c1
Sequence:CCGGCCAGAACATCATGTATGATATCTCGAGATATCATACATGATGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021614.2-1238s1c1
Sequence:CCGGCCAATGTTCTTAAGACTCTATCTCGAGATAGAGTCTTAAGAACATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021614.2-1725s1c1
Sequence:CCGGCTGCCAATGTACTCAGGGAAACTCGAGTTTCCCTGAGTACATTGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021614.2-2192s21c1
Sequence:CCGGAGCTAGAAGAGAATAAGTTAACTCGAGTTAACTTATTCTCTTCTAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021614.2-1209s21c1
Sequence:CCGGCCGCTGATGTGGATATTATTTCTCGAGAAATAATATCCACATCAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021614.2-1499s21c1
Sequence:CCGGGCGATGTGGTTGATATCAATACTCGAGTATTGATATCAACCACATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021614.2-2274s21c1
Sequence:CCGGTATGGTTCTAATCAGCGTTATCTCGAGATAACGCTGATTAGAACCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080465
KCNN2 MISSION shRNA Bacterial Glycerol Stock
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080465.1-793s1c1
Sequence:CCGGGCCAGAGTCATGCTATTACATCTCGAGATGTAATAGCATGACTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080465.1-1912s1c1
Sequence:CCGGGCACAGGGAATGCACCAATTACTCGAGTAATTGGTGCATTCCCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080465.1-1342s1c1
Sequence:CCGGCGGAAATTCTTGCAAGCTATTCTCGAGAATAGCTTGCAAGAATTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080465.1-201s1c1
Sequence:CCGGGCCGGAGCACAACAATTCTAACTCGAGTTAGAATTGTTGTGCTCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080465.1-1528s1c1
Sequence:CCGGGAGACTTTGATTGGTAGCATTCTCGAGAATGCTACCAATCAAAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080465
KCNN2 MISSION shRNA shRNA Plasmid DNA
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080465.1-793s1c1
Sequence:CCGGGCCAGAGTCATGCTATTACATCTCGAGATGTAATAGCATGACTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080465.1-1912s1c1
Sequence:CCGGGCACAGGGAATGCACCAATTACTCGAGTAATTGGTGCATTCCCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080465.1-1342s1c1
Sequence:CCGGCGGAAATTCTTGCAAGCTATTCTCGAGAATAGCTTGCAAGAATTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080465.1-201s1c1
Sequence:CCGGGCCGGAGCACAACAATTCTAACTCGAGTTAGAATTGTTGTGCTCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080465.1-1528s1c1
Sequence:CCGGGAGACTTTGATTGGTAGCATTCTCGAGAATGCTACCAATCAAAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080465
KCNN2 MISSION shRNA Lentiviral Transduction Particles
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080465.1-793s1c1
Sequence:CCGGGCCAGAGTCATGCTATTACATCTCGAGATGTAATAGCATGACTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080465.1-1912s1c1
Sequence:CCGGGCACAGGGAATGCACCAATTACTCGAGTAATTGGTGCATTCCCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080465.1-1342s1c1
Sequence:CCGGCGGAAATTCTTGCAAGCTATTCTCGAGAATAGCTTGCAAGAATTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080465.1-201s1c1
Sequence:CCGGGCCGGAGCACAACAATTCTAACTCGAGTTAGAATTGTTGTGCTCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080465.1-1528s1c1
Sequence:CCGGGAGACTTTGATTGGTAGCATTCTCGAGAATGCTACCAATCAAAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)