EMAIL THIS PAGE TO A FRIEND

KCNN3

potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3

103 Gene Product Result for
Synonyms: KCa2.3 SK3 SKCA3 hSK3
UniProtKB ID: Q9UGI6, B1ANX0, O43517, Q86VF9, Q8WXG7
Gene ID:
Human(3782) Summary: Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
Mouse(140493) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Rat(54263) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
domestic guinea pig(100733252) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
naked mole-rat(101721013) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
sheep(101112614) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Zebrafish(570138) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
dog(490441) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
cow(534180) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
domestic cat(101097043) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002249 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080466 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080466 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080466 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002249 Rosetta Predictions human pricing
NM_170782 Rosetta Predictions human pricing
NM_019315 Rosetta Predictions rat pricing
NM_080466 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085793 predicted 2223
2 SASI_Hs01_00085794 predicted 2044
3 SASI_Hs01_00085795 predicted 2302
4 SASI_Hs01_00085796 predicted 1863
5 SASI_Hs01_00085797 predicted 2016
6 SASI_Hs01_00085798 predicted 2027
7 SASI_Hs01_00085799 predicted 2207
8 SASI_Hs01_00085800 predicted 2530
9 SASI_Hs01_00085801 predicted 2042
10 SASI_Hs01_00085802 predicted 2080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175644 predicted 1151
2 SASI_Hs01_00175645 predicted 956
3 SASI_Hs01_00175646 predicted 1220
4 SASI_Hs01_00175647 predicted 775
5 SASI_Hs01_00175648 predicted 932
6 SASI_Hs01_00175649 predicted 945
7 SASI_Hs01_00175650 predicted 1136
8 SASI_Hs01_00175651 predicted 1452
9 SASI_Hs01_00175652 predicted 970
10 SASI_Hs01_00175653 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019315 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040995 predicted 817
2 SASI_Rn01_00040996 predicted 1261
3 SASI_Rn01_00040997 predicted 1168
4 SASI_Rn01_00040998 predicted 2101
5 SASI_Rn01_00040999 predicted 1271
6 SASI_Rn01_00041000 predicted 1172
7 SASI_Rn01_00041001 predicted 1768
8 SASI_Rn01_00041002 predicted 943
9 SASI_Rn01_00041003 predicted 1613
10 SASI_Rn01_00041004 predicted 1186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338136 predicted 2524
2 SASI_Mm01_00170637 predicted 1751
3 SASI_Mm02_00338137 predicted 2218
4 SASI_Mm02_00338138 predicted 2239
5 SASI_Mm01_00170638 predicted 1324
6 SASI_Mm02_00338139 predicted 822
7 SASI_Mm01_00170639 predicted 1179
8 SASI_Mm02_00338140 predicted 2038
9 SASI_Mm02_00338141 predicted 2052
10 SASI_Mm02_00338142 predicted 2533
11 SASI_Mm01_00170636 predicted 1516
12 SASI_Mm01_00170640 predicted 1815
13 SASI_Mm01_00170641 predicted 1856
14 SASI_Mm01_00170642 predicted 846
15 SASI_Mm01_00170643 predicted 925
16 SASI_Mm01_00170644 predicted 1757
17 SASI_Mm01_00170645 predicted 1522
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002249
KCNN3 MISSION shRNA Bacterial Glycerol Stock
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002249.4-836s21c1
Sequence:CCGGCATGAGCTCCTGCAAGTATAGCTCGAGCTATACTTGCAGGAGCTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002249.4-2218s21c1
Sequence:CCGGAGAATGTCATGTATGACTTAACTCGAGTTAAGTCATACATGACATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002249.3-716s1c1
Sequence:CCGGGCTCAATCTCAATGACCACTTCTCGAGAAGTGGTCATTGAGATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002249.4-2622s21c1
Sequence:CCGGAGACCGAGCTAATTAACTAACCTCGAGGTTAGTTAATTAGCTCGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002249.3-2500s1c1
Sequence:CCGGCGTACACAAGTTCAAGCAGTTCTCGAGAACTGCTTGAACTTGTGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002249.4-1964s21c1
Sequence:CCGGAGCGGAGAAGCACGTTCATAACTCGAGTTATGAACGTGCTTCTCCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002249.3-2054s1c1
Sequence:CCGGCCTTCGGGAAACATGGTTAATCTCGAGATTAACCATGTTTCCCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002249.3-1790s1c1
Sequence:CCGGGCAGGACGTAACTAGTAACTTCTCGAGAAGTTACTAGTTACGTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002249.3-1177s1c1
Sequence:CCGGTGAGTGACTATGCTCTGATTTCTCGAGAAATCAGAGCATAGTCACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002249
KCNN3 MISSION shRNA shRNA Plasmid DNA
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002249.4-836s21c1
Sequence:CCGGCATGAGCTCCTGCAAGTATAGCTCGAGCTATACTTGCAGGAGCTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002249.4-2218s21c1
Sequence:CCGGAGAATGTCATGTATGACTTAACTCGAGTTAAGTCATACATGACATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002249.3-716s1c1
Sequence:CCGGGCTCAATCTCAATGACCACTTCTCGAGAAGTGGTCATTGAGATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002249.4-2622s21c1
Sequence:CCGGAGACCGAGCTAATTAACTAACCTCGAGGTTAGTTAATTAGCTCGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002249.3-2500s1c1
Sequence:CCGGCGTACACAAGTTCAAGCAGTTCTCGAGAACTGCTTGAACTTGTGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002249.4-1964s21c1
Sequence:CCGGAGCGGAGAAGCACGTTCATAACTCGAGTTATGAACGTGCTTCTCCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002249.3-2054s1c1
Sequence:CCGGCCTTCGGGAAACATGGTTAATCTCGAGATTAACCATGTTTCCCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002249.3-1790s1c1
Sequence:CCGGGCAGGACGTAACTAGTAACTTCTCGAGAAGTTACTAGTTACGTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002249.3-1177s1c1
Sequence:CCGGTGAGTGACTATGCTCTGATTTCTCGAGAAATCAGAGCATAGTCACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002249
KCNN3 MISSION shRNA Lentiviral Transduction Particles
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002249.4-836s21c1
Sequence:CCGGCATGAGCTCCTGCAAGTATAGCTCGAGCTATACTTGCAGGAGCTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002249.4-2218s21c1
Sequence:CCGGAGAATGTCATGTATGACTTAACTCGAGTTAAGTCATACATGACATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002249.3-716s1c1
Sequence:CCGGGCTCAATCTCAATGACCACTTCTCGAGAAGTGGTCATTGAGATTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002249.4-2622s21c1
Sequence:CCGGAGACCGAGCTAATTAACTAACCTCGAGGTTAGTTAATTAGCTCGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002249.3-2500s1c1
Sequence:CCGGCGTACACAAGTTCAAGCAGTTCTCGAGAACTGCTTGAACTTGTGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002249.4-1964s21c1
Sequence:CCGGAGCGGAGAAGCACGTTCATAACTCGAGTTATGAACGTGCTTCTCCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002249.3-2054s1c1
Sequence:CCGGCCTTCGGGAAACATGGTTAATCTCGAGATTAACCATGTTTCCCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002249.3-1790s1c1
Sequence:CCGGGCAGGACGTAACTAGTAACTTCTCGAGAAGTTACTAGTTACGTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002249.3-1177s1c1
Sequence:CCGGTGAGTGACTATGCTCTGATTTCTCGAGAAATCAGAGCATAGTCACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080466
KCNN3 MISSION shRNA Bacterial Glycerol Stock
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080466.1-1182s1c1
Sequence:CCGGCCCTGGAGAGTACAAGTTCTTCTCGAGAAGAACTTGTACTCTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080466.1-1254s1c1
Sequence:CCGGCGTGGACATTATTCTGTCCATCTCGAGATGGACAGAATAATGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080466.1-1784s1c1
Sequence:CCGGCGTGGCTAGTCTATAAACATACTCGAGTATGTTTATAGACTAGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080466.1-1678s1c1
Sequence:CCGGCGAAAGCTCGAACTCACCAAACTCGAGTTTGGTGAGTTCGAGCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080466.1-435s1c1
Sequence:CCGGGCTAAATCTCAATGACCACTTCTCGAGAAGTGGTCATTGAGATTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080466
KCNN3 MISSION shRNA shRNA Plasmid DNA
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080466.1-1182s1c1
Sequence:CCGGCCCTGGAGAGTACAAGTTCTTCTCGAGAAGAACTTGTACTCTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080466.1-1254s1c1
Sequence:CCGGCGTGGACATTATTCTGTCCATCTCGAGATGGACAGAATAATGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080466.1-1784s1c1
Sequence:CCGGCGTGGCTAGTCTATAAACATACTCGAGTATGTTTATAGACTAGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080466.1-1678s1c1
Sequence:CCGGCGAAAGCTCGAACTCACCAAACTCGAGTTTGGTGAGTTCGAGCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080466.1-435s1c1
Sequence:CCGGGCTAAATCTCAATGACCACTTCTCGAGAAGTGGTCATTGAGATTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080466
KCNN3 MISSION shRNA Lentiviral Transduction Particles
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080466.1-1182s1c1
Sequence:CCGGCCCTGGAGAGTACAAGTTCTTCTCGAGAAGAACTTGTACTCTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080466.1-1254s1c1
Sequence:CCGGCGTGGACATTATTCTGTCCATCTCGAGATGGACAGAATAATGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080466.1-1784s1c1
Sequence:CCGGCGTGGCTAGTCTATAAACATACTCGAGTATGTTTATAGACTAGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080466.1-1678s1c1
Sequence:CCGGCGAAAGCTCGAACTCACCAAACTCGAGTTTGGTGAGTTCGAGCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080466.1-435s1c1
Sequence:CCGGGCTAAATCTCAATGACCACTTCTCGAGAAGTGGTCATTGAGATTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)