EMAIL THIS PAGE TO A FRIEND

KCNN4

potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4

60 Gene Product Result for
Synonyms: IK1 IKCA1 KCA4 KCa3.1 SK4 hIKCa1 hKCa4 hSK4
UniProtKB ID: O15554, Q53XR4
Gene ID:
Human(3783) Summary: The protein encoded by this gene is part of a potentially heterotetrameric voltage-independent potassium channel that is activated by intracellular calcium. Activation is followed by membrane hyperpolarization, which promotes calcium influx. The encoded protein may be part of the predominant calcium-activated potassium channel in T-lymphocytes. This gene is similar to other KCNN family potassium channel genes, but it differs enough to possibly be considered as part of a new subfamily. [provided by RefSeq, Jul 2008]
Mouse(16534) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
Rat(65206) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
domestic cat(101090475) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
dog(484464) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
cow(534591) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
sheep(101108597) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
domestic guinea pig(100379254) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
naked mole-rat(101708226) potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
N7634 Nifedipine ≥98% (HPLC), powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002250 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008433 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008433 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008433 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035251 MISSION® esiRNA esiRNA human KCNN4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002250 Rosetta Predictions human pricing
NM_023021 Rosetta Predictions rat pricing
NM_008433 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333498 predicted 1526
2 SASI_Hs01_00033486 predicted 1079
3 SASI_Hs01_00033487 predicted 568
4 SASI_Hs01_00033488 predicted 928
5 SASI_Hs01_00033490 predicted 495
6 SASI_Hs01_00033491 predicted 579
7 SASI_Hs01_00033492 predicted 970
8 SASI_Hs01_00033493 predicted 1478
9 SASI_Hs01_00033494 predicted 1096
10 SASI_Hs01_00033495 predicted 658
11 SASI_Hs01_00033489 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096996 predicted 1405
2 SASI_Rn01_00096997 predicted 1417
3 SASI_Rn01_00096998 predicted 820
4 SASI_Rn01_00096999 predicted 703
5 SASI_Rn01_00097000 predicted 892
6 SASI_Rn02_00263707 predicted 1470
7 SASI_Rn01_00097001 predicted 1215
8 SASI_Rn01_00097002 predicted 868
9 SASI_Rn01_00097003 predicted 790
10 SASI_Rn01_00097004 predicted 1535
11 SASI_Rn01_00097005 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031557 predicted 1443
2 SASI_Mm01_00031558 predicted 738
3 SASI_Mm01_00031559 predicted 1534
4 SASI_Mm01_00031560 predicted 1665
5 SASI_Mm01_00031561 predicted 1244
6 SASI_Mm01_00031563 predicted 1481
7 SASI_Mm02_00313907 predicted 895
8 SASI_Mm01_00031564 predicted 818
9 SASI_Mm01_00031565 predicted 703
10 SASI_Mm01_00031566 predicted 1430
11 SASI_Mm01_00031562 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002250
VALIDATED
KCNN4 MISSION shRNA Bacterial Glycerol Stock
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002250.2-1360s1c1
Sequence:CCGGGCCTGGATGTTCTACAAACATCTCGAGATGTTTGTAGAACATCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002250.2-1512s1c1
Sequence:CCGGCAAGATGCACATGATCCTGTACTCGAGTACAGGATCATGTGCATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002250.2-561s1c1
Sequence:CCGGGCTCTACCTGTTCCTGGTTAACTCGAGTTAACCAGGAACAGGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002250.2-1371s1c1
Sequence:CCGGCTACAAACATACTCGCAGGAACTCGAGTTCCTGCGAGTATGTTTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002250.2-945s1c1
Sequence:CCGGCGCTCTCAATCAAGTCCGCTTCTCGAGAAGCGGACTTGATTGAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002250.2-1299s21c1
Sequence:CCGGCATGATGGATATCCAGTATACCTCGAGGTATACTGGATATCCATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002250.2-2042s21c1
Sequence:CCGGATTCTGGGAGGCTTCAGTTACCTCGAGGTAACTGAAGCCTCCCAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002250.2-1360s21c1
Sequence:CCGGGCCTGGATGTTCTACAAACATCTCGAGATGTTTGTAGAACATCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002250.2-1512s21c1
Sequence:CCGGCAAGATGCACATGATCCTGTACTCGAGTACAGGATCATGTGCATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002250
VALIDATED
KCNN4 MISSION shRNA shRNA Plasmid DNA
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002250.2-1360s1c1
Sequence:CCGGGCCTGGATGTTCTACAAACATCTCGAGATGTTTGTAGAACATCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002250.2-1512s1c1
Sequence:CCGGCAAGATGCACATGATCCTGTACTCGAGTACAGGATCATGTGCATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002250.2-561s1c1
Sequence:CCGGGCTCTACCTGTTCCTGGTTAACTCGAGTTAACCAGGAACAGGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002250.2-1371s1c1
Sequence:CCGGCTACAAACATACTCGCAGGAACTCGAGTTCCTGCGAGTATGTTTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002250.2-945s1c1
Sequence:CCGGCGCTCTCAATCAAGTCCGCTTCTCGAGAAGCGGACTTGATTGAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002250.2-1299s21c1
Sequence:CCGGCATGATGGATATCCAGTATACCTCGAGGTATACTGGATATCCATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002250.2-2042s21c1
Sequence:CCGGATTCTGGGAGGCTTCAGTTACCTCGAGGTAACTGAAGCCTCCCAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002250.2-1360s21c1
Sequence:CCGGGCCTGGATGTTCTACAAACATCTCGAGATGTTTGTAGAACATCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002250.2-1512s21c1
Sequence:CCGGCAAGATGCACATGATCCTGTACTCGAGTACAGGATCATGTGCATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002250
VALIDATED
KCNN4 MISSION shRNA Lentiviral Transduction Particles
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002250.2-1360s1c1
Sequence:CCGGGCCTGGATGTTCTACAAACATCTCGAGATGTTTGTAGAACATCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002250.2-1512s1c1
Sequence:CCGGCAAGATGCACATGATCCTGTACTCGAGTACAGGATCATGTGCATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002250.2-561s1c1
Sequence:CCGGGCTCTACCTGTTCCTGGTTAACTCGAGTTAACCAGGAACAGGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002250.2-1371s1c1
Sequence:CCGGCTACAAACATACTCGCAGGAACTCGAGTTCCTGCGAGTATGTTTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002250.2-945s1c1
Sequence:CCGGCGCTCTCAATCAAGTCCGCTTCTCGAGAAGCGGACTTGATTGAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002250.2-1299s21c1
Sequence:CCGGCATGATGGATATCCAGTATACCTCGAGGTATACTGGATATCCATCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002250.2-2042s21c1
Sequence:CCGGATTCTGGGAGGCTTCAGTTACCTCGAGGTAACTGAAGCCTCCCAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002250.2-1360s21c1
Sequence:CCGGGCCTGGATGTTCTACAAACATCTCGAGATGTTTGTAGAACATCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002250.2-1512s21c1
Sequence:CCGGCAAGATGCACATGATCCTGTACTCGAGTACAGGATCATGTGCATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008433
VALIDATED
KCNN4 MISSION shRNA Bacterial Glycerol Stock
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.4-381s21c1
Sequence:CCGGTGCCTTCCTCCTTTGTCTTATCTCGAGATAAGACAAAGGAGGAAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008433.2-391s1c1
Sequence:CCGGCCTTTGTCTTATTGTGGTCTTCTCGAGAAGACCACAATAAGACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008433.2-891s1c1
Sequence:CCGGTGTGGCTGATTCCGATCACATCTCGAGATGTGATCGGAATCAGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008433.2-1037s1c1
Sequence:CCGGGAGTTCAACAAGGCGGAGAAACTCGAGTTTCTCCGCCTTGTTGAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008433.2-1279s1c1
Sequence:CCGGCATCTCCAAGATGCACATGATCTCGAGATCATGTGCATCTTGGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008433.2-427s1c1
Sequence:CCGGCCAGCTGTTCATGACTGACAACTCGAGTTGTCAGTCATGAACAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008433.4-1757s21c1
Sequence:CCGGATGCTAGGAAGCTTCAGTTAACTCGAGTTAACTGAAGCTTCCTAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.3-1037s21c1
Sequence:CCGGAGTTCAACAAGGCGGAGAAACCTCGAGGTTTCTCCGCCTTGTTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.3-890s21c1
Sequence:CCGGTGTGGCTGATTCCGATCACATCTCGAGATGTGATCGGAATCAGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.4-1069s21c1
Sequence:CCGGTTCATGATGGACATCCATTATCTCGAGATAATGGATGTCCATCATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.4-346s21c1
Sequence:CCGGCTGCTCCTGGTTAAGTGTTTGCTCGAGCAAACACTTAACCAGGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008433.3-1653s21c1
Sequence:CCGGCATGGCCACCACTACACATATCTCGAGATATGTGTAGTGGTGGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.3-1068s21c1
Sequence:CCGGCTTCATGATGGACATCCATTACTCGAGTAATGGATGTCCATCATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.3-340s21c1
Sequence:CCGGCTGTACCTGCTCCTGGTTAAGCTCGAGCTTAACCAGGAGCAGGTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008433
VALIDATED
KCNN4 MISSION shRNA shRNA Plasmid DNA
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.4-381s21c1
Sequence:CCGGTGCCTTCCTCCTTTGTCTTATCTCGAGATAAGACAAAGGAGGAAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008433.2-391s1c1
Sequence:CCGGCCTTTGTCTTATTGTGGTCTTCTCGAGAAGACCACAATAAGACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008433.2-891s1c1
Sequence:CCGGTGTGGCTGATTCCGATCACATCTCGAGATGTGATCGGAATCAGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008433.2-1037s1c1
Sequence:CCGGGAGTTCAACAAGGCGGAGAAACTCGAGTTTCTCCGCCTTGTTGAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008433.2-1279s1c1
Sequence:CCGGCATCTCCAAGATGCACATGATCTCGAGATCATGTGCATCTTGGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008433.2-427s1c1
Sequence:CCGGCCAGCTGTTCATGACTGACAACTCGAGTTGTCAGTCATGAACAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008433.4-1757s21c1
Sequence:CCGGATGCTAGGAAGCTTCAGTTAACTCGAGTTAACTGAAGCTTCCTAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.3-1037s21c1
Sequence:CCGGAGTTCAACAAGGCGGAGAAACCTCGAGGTTTCTCCGCCTTGTTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.3-890s21c1
Sequence:CCGGTGTGGCTGATTCCGATCACATCTCGAGATGTGATCGGAATCAGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.4-1069s21c1
Sequence:CCGGTTCATGATGGACATCCATTATCTCGAGATAATGGATGTCCATCATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.4-346s21c1
Sequence:CCGGCTGCTCCTGGTTAAGTGTTTGCTCGAGCAAACACTTAACCAGGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008433.3-1653s21c1
Sequence:CCGGCATGGCCACCACTACACATATCTCGAGATATGTGTAGTGGTGGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.3-1068s21c1
Sequence:CCGGCTTCATGATGGACATCCATTACTCGAGTAATGGATGTCCATCATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.3-340s21c1
Sequence:CCGGCTGTACCTGCTCCTGGTTAAGCTCGAGCTTAACCAGGAGCAGGTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008433
VALIDATED
KCNN4 MISSION shRNA Lentiviral Transduction Particles
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.4-381s21c1
Sequence:CCGGTGCCTTCCTCCTTTGTCTTATCTCGAGATAAGACAAAGGAGGAAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008433.2-391s1c1
Sequence:CCGGCCTTTGTCTTATTGTGGTCTTCTCGAGAAGACCACAATAAGACAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008433.2-891s1c1
Sequence:CCGGTGTGGCTGATTCCGATCACATCTCGAGATGTGATCGGAATCAGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008433.2-1037s1c1
Sequence:CCGGGAGTTCAACAAGGCGGAGAAACTCGAGTTTCTCCGCCTTGTTGAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008433.2-1279s1c1
Sequence:CCGGCATCTCCAAGATGCACATGATCTCGAGATCATGTGCATCTTGGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008433.2-427s1c1
Sequence:CCGGCCAGCTGTTCATGACTGACAACTCGAGTTGTCAGTCATGAACAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008433.4-1757s21c1
Sequence:CCGGATGCTAGGAAGCTTCAGTTAACTCGAGTTAACTGAAGCTTCCTAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.3-1037s21c1
Sequence:CCGGAGTTCAACAAGGCGGAGAAACCTCGAGGTTTCTCCGCCTTGTTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.3-890s21c1
Sequence:CCGGTGTGGCTGATTCCGATCACATCTCGAGATGTGATCGGAATCAGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.4-1069s21c1
Sequence:CCGGTTCATGATGGACATCCATTATCTCGAGATAATGGATGTCCATCATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.4-346s21c1
Sequence:CCGGCTGCTCCTGGTTAAGTGTTTGCTCGAGCAAACACTTAACCAGGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008433.3-1653s21c1
Sequence:CCGGCATGGCCACCACTACACATATCTCGAGATATGTGTAGTGGTGGCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.3-1068s21c1
Sequence:CCGGCTTCATGATGGACATCCATTACTCGAGTAATGGATGTCCATCATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008433.3-340s21c1
Sequence:CCGGCTGTACCTGCTCCTGGTTAAGCTCGAGCTTAACCAGGAGCAGGTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)