EMAIL THIS PAGE TO A FRIEND

KCNQ1

potassium voltage-gated channel, KQT-like subfamily, member 1

93 Gene Product Result for
Synonyms: ATFB1 ATFB3 JLNS1 KCNA8 KCNA9 KVLQT1 Kv1.9 Kv7.1 LQT LQT1 RWS SQT2 WRS
Gene ID:
Human(3784) Summary: This gene encodes a voltage-gated potassium channel required for repolarization phase of the cardiac action potential. This protein can form heteromultimers with two other potassium channel proteins, KCNE1 and KCNE3. Mutations in this gene are associated with hereditary long QT syndrome 1 (also known as Romano-Ward syndrome), Jervell and Lange-Nielsen syndrome, and familial atrial fibrillation. This gene exhibits tissue-specific imprinting, with preferential expression from the maternal allele in some tissues, and biallelic expression in others. This gene is located in a region of chromosome 11 amongst other imprinted genes that are associated with Beckwith-Wiedemann syndrome (BWS), and itself has been shown to be disrupted by chromosomal rearrangements in patients with BWS. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(16535) potassium voltage-gated channel, subfamily Q, member 1
Rat(84020) potassium voltage-gated channel, KQT-like subfamily, member 1
Zebrafish(557498) potassium voltage-gated channel, KQT-like subfamily, member 1
chicken(423090) potassium voltage-gated channel, KQT-like subfamily, member 1
cow(784876) potassium voltage-gated channel, KQT-like subfamily, member 1
Horse(100034129) potassium voltage-gated channel, KQT-like subfamily, member 1
domestic cat(101092644) potassium voltage-gated channel, KQT-like subfamily, member 1
dog(483669) potassium voltage-gated channel, KQT-like subfamily, member 1
domestic guinea pig(100379230) potassium voltage-gated channel, subfamily Q, member 1
naked mole-rat(101725681) potassium voltage-gated channel, KQT-like subfamily, member 1
sheep(101119596) potassium voltage-gated channel, KQT-like subfamily, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008434 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008434 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008434 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000218 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000218 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000218 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000218 Rosetta Predictions human pricing
NM_181797 Rosetta Predictions human pricing
NM_181798 Rosetta Predictions human pricing
NM_032073 Rosetta Predictions rat pricing
NM_008434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120723 predicted 1648
2 SASI_Hs01_00120724 predicted 2446
3 SASI_Hs02_00302113 predicted 689
4 SASI_Hs01_00120725 predicted 2056
5 SASI_Hs01_00120726 predicted 1596
6 SASI_Hs01_00120727 predicted 1819
7 SASI_Hs01_00120728 predicted 2071
8 SASI_Hs01_00120729 predicted 1668
9 SASI_Hs01_00120730 predicted 2345
10 SASI_Hs01_00120731 predicted 2384
11 SASI_Hs01_00120722 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180135 predicted 866
2 SASI_Hs01_00180136 predicted 1412
3 SASI_Hs01_00180137 predicted 2218
4 SASI_Hs01_00180138 predicted 1354
5 SASI_Hs01_00180139 predicted 1582
6 SASI_Hs01_00180140 predicted 1431
7 SASI_Hs01_00180141 predicted 2147
8 SASI_Hs01_00180142 predicted 1565
9 SASI_Hs01_00180143 predicted 1395
10 SASI_Hs01_00180144 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098487 predicted 1412
2 SASI_Hs01_00098488 predicted 2216
3 SASI_Hs02_00370400 predicted 459
4 SASI_Hs01_00098489 predicted 1360
5 SASI_Hs01_00098490 predicted 1590
6 SASI_Hs01_00098491 predicted 1437
7 SASI_Hs01_00098492 predicted 2157
8 SASI_Hs01_00098493 predicted 1558
9 SASI_Hs01_00098494 predicted 1391
10 SASI_Hs01_00098486 predicted 863
11 SASI_Hs01_00098495 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032073 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079602 predicted 870
2 SASI_Rn01_00079604 predicted 670
3 SASI_Rn01_00079605 predicted 1226
4 SASI_Rn01_00079607 predicted 1974
5 SASI_Rn01_00079608 predicted 1736
6 SASI_Rn01_00079609 predicted 1118
7 SASI_Rn02_00265433 predicted 1820
8 SASI_Rn01_00079610 predicted 1396
9 SASI_Rn01_00079611 predicted 1235
10 SASI_Rn02_00265434 predicted 932
11 SASI_Rn01_00079603 predicted 1246
12 SASI_Rn01_00079606 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091625 predicted 715
2 SASI_Mm01_00091626 predicted 1867
3 SASI_Mm01_00091627 predicted 1835
4 SASI_Mm01_00091629 predicted 1359
5 SASI_Mm01_00091630 predicted 1753
6 SASI_Mm01_00091631 predicted 1400
7 SASI_Mm01_00091632 predicted 599
8 SASI_Mm01_00091633 predicted 456
9 SASI_Mm01_00091634 predicted 2011
10 SASI_Mm02_00313908 predicted 941
11 SASI_Mm01_00091628 predicted 885
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008434
KCNQ1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, KQT-like subfamily, member 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008434.2-1370s21c1
Sequence:CCGGTCAAGCTGGATAAGGATAATGCTCGAGCATTATCCTTATCCAGCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008434.2-1418s21c1
Sequence:CCGGATGTTCCTCACATCACTTATGCTCGAGCATAAGTGATGTGAGGAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008434.1-2364s1c1
Sequence:CCGGCCACACTAAATGCAGGCTGTACTCGAGTACAGCCTGCATTTAGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008434.1-1311s1c1
Sequence:CCGGGCCCTACACTGCTGGAATTAACTCGAGTTAATTCCAGCAGTGTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008434.1-1691s1c1
Sequence:CCGGGTGGAAGACAAGGTGACACAACTCGAGTTGTGTCACCTTGTCTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008434.1-1572s1c1
Sequence:CCGGGCATTAAAGAACTACAGAGAACTCGAGTTCTCTGTAGTTCTTTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008434.1-331s1c1
Sequence:CCGGCCTGTCCACTATTGAGCAGTACTCGAGTACTGCTCAATAGTGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008434
KCNQ1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, KQT-like subfamily, member 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008434.2-1370s21c1
Sequence:CCGGTCAAGCTGGATAAGGATAATGCTCGAGCATTATCCTTATCCAGCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008434.2-1418s21c1
Sequence:CCGGATGTTCCTCACATCACTTATGCTCGAGCATAAGTGATGTGAGGAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008434.1-2364s1c1
Sequence:CCGGCCACACTAAATGCAGGCTGTACTCGAGTACAGCCTGCATTTAGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008434.1-1311s1c1
Sequence:CCGGGCCCTACACTGCTGGAATTAACTCGAGTTAATTCCAGCAGTGTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008434.1-1691s1c1
Sequence:CCGGGTGGAAGACAAGGTGACACAACTCGAGTTGTGTCACCTTGTCTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008434.1-1572s1c1
Sequence:CCGGGCATTAAAGAACTACAGAGAACTCGAGTTCTCTGTAGTTCTTTAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008434.1-331s1c1
Sequence:CCGGCCTGTCCACTATTGAGCAGTACTCGAGTACTGCTCAATAGTGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008434
KCNQ1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, KQT-like subfamily, member 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008434.2-1370s21c1
Sequence:CCGGTCAAGCTGGATAAGGATAATGCTCGAGCATTATCCTTATCCAGCTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008434.2-1418s21c1
Sequence:CCGGATGTTCCTCACATCACTTATGCTCGAGCATAAGTGATGTGAGGAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008434.1-2364s1c1
Sequence:CCGGCCACACTAAATGCAGGCTGTACTCGAGTACAGCCTGCATTTAGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008434.1-1311s1c1
Sequence:CCGGGCCCTACACTGCTGGAATTAACTCGAGTTAATTCCAGCAGTGTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008434.1-1691s1c1
Sequence:CCGGGTGGAAGACAAGGTGACACAACTCGAGTTGTGTCACCTTGTCTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008434.1-1572s1c1
Sequence:CCGGGCATTAAAGAACTACAGAGAACTCGAGTTCTCTGTAGTTCTTTAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008434.1-331s1c1
Sequence:CCGGCCTGTCCACTATTGAGCAGTACTCGAGTACTGCTCAATAGTGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000218
KCNQ1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, KQT-like subfamily, member 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-533s21c1
Sequence:CCGGTGTCCACCATCGAGCAGTATGCTCGAGCATACTGCTCGATGGTGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-1275s21c1
Sequence:CCGGCTCCACCTGGAAGATCTACATCTCGAGATGTAGATCTTCCAGGTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-1714s21c1
Sequence:CCGGTACGATGTGCGGGACGTCATTCTCGAGAATGACGTCCCGCACATCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-1658s21c1
Sequence:CCGGTTCGACGCATGCAGTACTTTGCTCGAGCAAAGTACTGCATGCGTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-1344s21c1
Sequence:CCGGCAAGAAGTCTGTGGTGGTAAACTCGAGTTTACCACCACAGACTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-1109s21c1
Sequence:CCGGTCTTTGCCATCTCCTTCTTTGCTCGAGCAAAGAAGGAGATGGCAAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-1758s21c1
Sequence:CCGGCAACCTCATGGTGCGCATCAACTCGAGTTGATGCGCACCATGAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000218.2-3060s21c1
Sequence:CCGGATGAGTTTCACAGTGTGATTTCTCGAGAAATCACACTGTGAAACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000218.2-3013s21c1
Sequence:CCGGCATCGCATAGAAATCAATAATCTCGAGATTATTGATTTCTATGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-926s21c1
Sequence:CCGGTCATCTTCTCCTCGTACTTTGCTCGAGCAAAGTACGAGGAGAAGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000218.2-891s1c1
Sequence:CCGGGCTGATAACCACCCTGTACATCTCGAGATGTACAGGGTGGTTATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000218.2-1923s1c1
Sequence:CCGGGCTGGCACTCATCACCGACATCTCGAGATGTCGGTGATGAGTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000218.2-1483s1c1
Sequence:CCGGGACGGCTATGACAGTTCTGTACTCGAGTACAGAACTGTCATAGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000218.2-1681s1c1
Sequence:CCGGGCCAAGAAGAAATTCCAGCAACTCGAGTTGCTGGAATTTCTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000218.2-462s1c1
Sequence:CCGGCGGCTGGAAATGCTTCGTTTACTCGAGTAAACGAAGCATTTCCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000218
KCNQ1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, KQT-like subfamily, member 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-533s21c1
Sequence:CCGGTGTCCACCATCGAGCAGTATGCTCGAGCATACTGCTCGATGGTGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-1275s21c1
Sequence:CCGGCTCCACCTGGAAGATCTACATCTCGAGATGTAGATCTTCCAGGTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-1714s21c1
Sequence:CCGGTACGATGTGCGGGACGTCATTCTCGAGAATGACGTCCCGCACATCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-1658s21c1
Sequence:CCGGTTCGACGCATGCAGTACTTTGCTCGAGCAAAGTACTGCATGCGTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-1344s21c1
Sequence:CCGGCAAGAAGTCTGTGGTGGTAAACTCGAGTTTACCACCACAGACTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-1109s21c1
Sequence:CCGGTCTTTGCCATCTCCTTCTTTGCTCGAGCAAAGAAGGAGATGGCAAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-1758s21c1
Sequence:CCGGCAACCTCATGGTGCGCATCAACTCGAGTTGATGCGCACCATGAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000218.2-3060s21c1
Sequence:CCGGATGAGTTTCACAGTGTGATTTCTCGAGAAATCACACTGTGAAACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000218.2-3013s21c1
Sequence:CCGGCATCGCATAGAAATCAATAATCTCGAGATTATTGATTTCTATGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-926s21c1
Sequence:CCGGTCATCTTCTCCTCGTACTTTGCTCGAGCAAAGTACGAGGAGAAGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000218.2-891s1c1
Sequence:CCGGGCTGATAACCACCCTGTACATCTCGAGATGTACAGGGTGGTTATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000218.2-1923s1c1
Sequence:CCGGGCTGGCACTCATCACCGACATCTCGAGATGTCGGTGATGAGTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000218.2-1483s1c1
Sequence:CCGGGACGGCTATGACAGTTCTGTACTCGAGTACAGAACTGTCATAGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000218.2-1681s1c1
Sequence:CCGGGCCAAGAAGAAATTCCAGCAACTCGAGTTGCTGGAATTTCTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000218.2-462s1c1
Sequence:CCGGCGGCTGGAAATGCTTCGTTTACTCGAGTAAACGAAGCATTTCCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000218
KCNQ1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, KQT-like subfamily, member 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-533s21c1
Sequence:CCGGTGTCCACCATCGAGCAGTATGCTCGAGCATACTGCTCGATGGTGGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-1275s21c1
Sequence:CCGGCTCCACCTGGAAGATCTACATCTCGAGATGTAGATCTTCCAGGTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-1714s21c1
Sequence:CCGGTACGATGTGCGGGACGTCATTCTCGAGAATGACGTCCCGCACATCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-1658s21c1
Sequence:CCGGTTCGACGCATGCAGTACTTTGCTCGAGCAAAGTACTGCATGCGTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-1344s21c1
Sequence:CCGGCAAGAAGTCTGTGGTGGTAAACTCGAGTTTACCACCACAGACTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-1109s21c1
Sequence:CCGGTCTTTGCCATCTCCTTCTTTGCTCGAGCAAAGAAGGAGATGGCAAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-1758s21c1
Sequence:CCGGCAACCTCATGGTGCGCATCAACTCGAGTTGATGCGCACCATGAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000218.2-3060s21c1
Sequence:CCGGATGAGTTTCACAGTGTGATTTCTCGAGAAATCACACTGTGAAACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000218.2-3013s21c1
Sequence:CCGGCATCGCATAGAAATCAATAATCTCGAGATTATTGATTTCTATGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000218.2-926s21c1
Sequence:CCGGTCATCTTCTCCTCGTACTTTGCTCGAGCAAAGTACGAGGAGAAGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000218.2-891s1c1
Sequence:CCGGGCTGATAACCACCCTGTACATCTCGAGATGTACAGGGTGGTTATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000218.2-1923s1c1
Sequence:CCGGGCTGGCACTCATCACCGACATCTCGAGATGTCGGTGATGAGTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000218.2-1483s1c1
Sequence:CCGGGACGGCTATGACAGTTCTGTACTCGAGTACAGAACTGTCATAGCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000218.2-1681s1c1
Sequence:CCGGGCCAAGAAGAAATTCCAGCAACTCGAGTTGCTGGAATTTCTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000218.2-462s1c1
Sequence:CCGGCGGCTGGAAATGCTTCGTTTACTCGAGTAAACGAAGCATTTCCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)