EMAIL THIS PAGE TO A FRIEND

KCNQ2

potassium voltage-gated channel, KQT-like subfamily, member 2

223 Gene Product Result for
Synonyms: BFNC BFNS1 EBN EBN1 EIEE7 ENB1 HNSPC KCNA11 KV7.2 KVEBN1
Gene ID:
Human(3785) Summary: The M channel is a slowly activating and deactivating potassium channel that plays a critical role in the regulation of neuronal excitability. The M channel is formed by the association of the protein encoded by this gene and a related protein encoded by the KCNQ3 gene, both integral membrane proteins. M channel currents are inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 1 (BFNC), also known as epilepsy, benign neonatal type 1 (EBN1). At least five transcript variants encoding five different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16536) potassium voltage-gated channel, subfamily Q, member 2
Rat(170848) potassium voltage-gated channel, KQT-like subfamily, member 2
sheep(101118630) potassium voltage-gated channel, KQT-like subfamily, member 2
domestic guinea pig(100732168) potassium voltage-gated channel, KQT-like subfamily, member 2
naked mole-rat(101715997) potassium voltage-gated channel, KQT-like subfamily, member 2
Zebrafish(100537363) potassium voltage-gated channel, KQT-like subfamily, member 2
chicken(428151) potassium voltage-gated channel, KQT-like subfamily, member 2
domestic cat(101101044) potassium voltage-gated channel, KQT-like subfamily, member 2
cow(505963) potassium voltage-gated channel, KQT-like subfamily, member 2
Horse(100146986) potassium voltage-gated channel, KQT-like subfamily, member 2
dog(612515) potassium voltage-gated channel, KQT-like subfamily, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV35456 Anti-KCNQ2 (AB1) antibody produced in rabbit affinity isolated antibody canine, rabbit, horse, rat, bovine, zebrafish, rabbit, human, mouse, guinea pig
western blot pricing
AV35458 Anti-KCNQ2 (AB2) antibody produced in rabbit affinity isolated antibody canine, horse, rabbit, human, guinea pig, rabbit, mouse, zebrafish, rat
immunohistochemistry, western blot pricing
HPA016642 Anti-KCNQ2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV35459 Anti-KCNQ2 antibody produced in rabbit IgG fraction of antiserum human, mouse, zebrafish, rabbit, rabbit, guinea pig, rat, horse, bovine, canine
immunohistochemistry, western blot pricing
HPA057112 Anti-KCNQ2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
SAB2104245 Anti-KCNQ2 antibody produced in rabbit affinity isolated antibody rabbit, horse, rabbit, guinea pig, rat, mouse, zebrafish, human
immunohistochemistry, western blot pricing
SAB2106356 Anti-KCNQ2 antibody produced in rabbit affinity isolated antibody horse, guinea pig, human, rabbit, mouse
western blot pricing
P4371 Anti-Potassium Channel KCNQ2 antibody produced in rabbit affinity isolated antibody, lyophilized powder rat
western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
E3876 N-Ethylmaleimide crystalline, ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004518 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004518 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004518 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001006674 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001006674 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001006674 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124741 MISSION® esiRNA esiRNA human KCNQ2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004518 Rosetta Predictions human pricing
NM_172106 Rosetta Predictions human pricing
NM_172107 Rosetta Predictions human pricing
NM_172108 Rosetta Predictions human pricing
NM_172109 Rosetta Predictions human pricing
NM_133322 Rosetta Predictions rat pricing
NM_001003824 Rosetta Predictions mouse pricing
NM_001003825 Rosetta Predictions mouse pricing
NM_001006668 Rosetta Predictions mouse pricing
NM_001006669 Rosetta Predictions mouse pricing
NM_001006674 Rosetta Predictions mouse pricing
NM_001006675 Rosetta Predictions mouse pricing
NM_001006676 Rosetta Predictions mouse pricing
NM_001006677 Rosetta Predictions mouse pricing
NM_001006678 Rosetta Predictions mouse pricing
NM_001006679 Rosetta Predictions mouse pricing
NM_001006680 Rosetta Predictions mouse pricing
NM_010611 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080705 predicted 654
2 SASI_Hs02_00337798 predicted 672
3 SASI_Hs01_00080706 predicted 1055
4 SASI_Hs01_00080707 predicted 675
5 SASI_Hs01_00080708 predicted 648
6 SASI_Hs01_00080709 predicted 908
7 SASI_Hs01_00080710 predicted 692
8 SASI_Hs01_00080712 predicted 909
9 SASI_Hs01_00080713 predicted 668
10 SASI_Hs01_00080714 predicted 584
11 SASI_Hs01_00080711 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244110 predicted 655
2 SASI_Hs02_00367830 predicted 672
3 SASI_Hs01_00244111 predicted 1057
4 SASI_Hs01_00244112 predicted 672
5 SASI_Hs01_00244113 predicted 653
6 SASI_Hs01_00244114 predicted 911
7 SASI_Hs01_00244115 predicted 694
8 SASI_Hs01_00244117 predicted 908
9 SASI_Hs01_00244118 predicted 663
10 SASI_Hs01_00244119 predicted 584
11 SASI_Hs01_00244116 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022302 predicted 650
2 SASI_Hs02_00367831 predicted 675
3 SASI_Hs01_00022303 predicted 1056
4 SASI_Hs01_00022304 predicted 673
5 SASI_Hs01_00022305 predicted 652
6 SASI_Hs01_00022306 predicted 914
7 SASI_Hs01_00022307 predicted 691
8 SASI_Hs01_00022309 predicted 907
9 SASI_Hs01_00022310 predicted 662
10 SASI_Hs01_00022311 predicted 584
11 SASI_Hs01_00022308 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107112 predicted 649
2 SASI_Hs02_00367832 predicted 673
3 SASI_Hs01_00107113 predicted 1061
4 SASI_Hs01_00107114 predicted 674
5 SASI_Hs01_00107115 predicted 656
6 SASI_Hs01_00107116 predicted 907
7 SASI_Hs01_00107117 predicted 691
8 SASI_Hs01_00107119 predicted 908
9 SASI_Hs01_00107120 predicted 667
10 SASI_Hs01_00107121 predicted 576
11 SASI_Hs01_00107118 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211841 predicted 649
2 SASI_Hs02_00367833 predicted 678
3 SASI_Hs01_00211842 predicted 1054
4 SASI_Hs01_00211843 predicted 673
5 SASI_Hs01_00211844 predicted 649
6 SASI_Hs01_00211845 predicted 914
7 SASI_Hs01_00211846 predicted 696
8 SASI_Hs01_00211848 predicted 906
9 SASI_Hs01_00211849 predicted 663
10 SASI_Hs01_00211850 predicted 576
11 SASI_Hs01_00211847 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133322 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093629 predicted 1749
2 SASI_Rn01_00093630 predicted 2110
3 SASI_Rn01_00093631 predicted 985
4 SASI_Rn01_00093632 predicted 1715
5 SASI_Rn01_00093633 predicted 1692
6 SASI_Rn02_00267631 predicted 934
7 SASI_Rn01_00093635 predicted 2552
8 SASI_Rn01_00093636 predicted 618
9 SASI_Rn01_00093637 predicted 2116
10 SASI_Rn01_00093638 predicted 1796
11 SASI_Rn01_00093634 predicted 2469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093463 predicted 725
2 SASI_Mm01_00093464 predicted 498
3 SASI_Mm01_00093465 predicted 627
4 SASI_Mm01_00093466 predicted 818
5 SASI_Mm01_00093467 predicted 401
6 SASI_Mm01_00093468 predicted 467
7 SASI_Mm01_00093469 predicted 784
8 SASI_Mm02_00286338 predicted 781
9 SASI_Mm01_00093470 predicted 532
10 SASI_Mm01_00093471 predicted 357
11 SASI_Mm01_00093472 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085911 predicted 717
2 SASI_Mm01_00085912 predicted 501
3 SASI_Mm01_00085913 predicted 631
4 SASI_Mm01_00085914 predicted 820
5 SASI_Mm01_00085915 predicted 398
6 SASI_Mm01_00085916 predicted 466
7 SASI_Mm01_00085917 predicted 786
8 SASI_Mm02_00286339 predicted 786
9 SASI_Mm01_00085918 predicted 535
10 SASI_Mm01_00085919 predicted 352
11 SASI_Mm01_00085920 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046037 predicted 726
2 SASI_Mm01_00046038 predicted 502
3 SASI_Mm01_00046039 predicted 623
4 SASI_Mm01_00046040 predicted 823
5 SASI_Mm01_00046041 predicted 401
6 SASI_Mm01_00046042 predicted 466
7 SASI_Mm01_00046043 predicted 786
8 SASI_Mm02_00286705 predicted 777
9 SASI_Mm01_00046044 predicted 526
10 SASI_Mm01_00046045 predicted 354
11 SASI_Mm01_00046046 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085302 predicted 726
2 SASI_Mm01_00085303 predicted 503
3 SASI_Mm01_00085304 predicted 627
4 SASI_Mm01_00085305 predicted 821
5 SASI_Mm01_00085306 predicted 403
6 SASI_Mm01_00085307 predicted 466
7 SASI_Mm01_00085308 predicted 789
8 SASI_Mm02_00286706 predicted 781
9 SASI_Mm01_00085309 predicted 533
10 SASI_Mm01_00085310 predicted 358
11 SASI_Mm01_00085311 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006674 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115865 predicted 724
2 SASI_Mm01_00115866 predicted 506
3 SASI_Mm01_00115867 predicted 627
4 SASI_Mm01_00115868 predicted 823
5 SASI_Mm01_00115869 predicted 401
6 SASI_Mm01_00115870 predicted 469
7 SASI_Mm01_00115871 predicted 788
8 SASI_Mm02_00286707 predicted 786
9 SASI_Mm01_00115872 predicted 528
10 SASI_Mm01_00115873 predicted 353
11 SASI_Mm01_00115874 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067993 predicted 724
2 SASI_Mm01_00067994 predicted 499
3 SASI_Mm01_00067995 predicted 626
4 SASI_Mm01_00067996 predicted 823
5 SASI_Mm01_00067997 predicted 405
6 SASI_Mm01_00067998 predicted 471
7 SASI_Mm01_00067999 predicted 782
8 SASI_Mm02_00286708 predicted 786
9 SASI_Mm01_00068000 predicted 530
10 SASI_Mm01_00068001 predicted 356
11 SASI_Mm01_00068002 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006676 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079474 predicted 722
2 SASI_Mm01_00079475 predicted 503
3 SASI_Mm01_00079476 predicted 628
4 SASI_Mm01_00079477 predicted 826
5 SASI_Mm01_00079478 predicted 400
6 SASI_Mm01_00079479 predicted 472
7 SASI_Mm01_00079480 predicted 782
8 SASI_Mm02_00286709 predicted 777
9 SASI_Mm01_00079481 predicted 532
10 SASI_Mm01_00079482 predicted 353
11 SASI_Mm01_00079483 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006677 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034577 predicted 720
2 SASI_Mm01_00034578 predicted 500
3 SASI_Mm01_00034579 predicted 624
4 SASI_Mm01_00034580 predicted 817
5 SASI_Mm01_00034581 predicted 400
6 SASI_Mm01_00034582 predicted 467
7 SASI_Mm01_00034583 predicted 787
8 SASI_Mm02_00286710 predicted 778
9 SASI_Mm01_00034584 predicted 535
10 SASI_Mm01_00034585 predicted 358
11 SASI_Mm01_00034586 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161142 predicted 717
2 SASI_Mm01_00161143 predicted 503
3 SASI_Mm01_00161144 predicted 624
4 SASI_Mm01_00161145 predicted 819
5 SASI_Mm01_00161146 predicted 400
6 SASI_Mm01_00161147 predicted 465
7 SASI_Mm01_00161148 predicted 790
8 SASI_Mm02_00286711 predicted 781
9 SASI_Mm01_00161149 predicted 532
10 SASI_Mm01_00161150 predicted 361
11 SASI_Mm01_00161151 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109932 predicted 718
2 SASI_Mm01_00109933 predicted 497
3 SASI_Mm01_00109934 predicted 630
4 SASI_Mm01_00109935 predicted 826
5 SASI_Mm01_00109936 predicted 405
6 SASI_Mm01_00109937 predicted 466
7 SASI_Mm01_00109938 predicted 787
8 SASI_Mm02_00286712 predicted 783
9 SASI_Mm01_00109939 predicted 530
10 SASI_Mm01_00109940 predicted 353
11 SASI_Mm01_00109941 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194945 predicted 726
2 SASI_Mm01_00194946 predicted 504
3 SASI_Mm01_00194947 predicted 626
4 SASI_Mm01_00194948 predicted 824
5 SASI_Mm01_00194949 predicted 400
6 SASI_Mm01_00194950 predicted 464
7 SASI_Mm01_00194951 predicted 788
8 SASI_Mm02_00286713 predicted 777
9 SASI_Mm01_00194952 predicted 527
10 SASI_Mm01_00194953 predicted 361
11 SASI_Mm01_00194954 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136006 predicted 717
2 SASI_Mm01_00136007 predicted 497
3 SASI_Mm01_00136008 predicted 631
4 SASI_Mm01_00136009 predicted 819
5 SASI_Mm01_00136010 predicted 406
6 SASI_Mm01_00136011 predicted 470
7 SASI_Mm01_00136012 predicted 782
8 SASI_Mm02_00318929 predicted 786
9 SASI_Mm01_00136013 predicted 527
10 SASI_Mm01_00136014 predicted 354
11 SASI_Mm01_00136015 predicted 577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004518
KCNQ2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, KQT-like subfamily, member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004518.4-559s21c1
Sequence:CCGGATCCTGGAAATCGTGACTATCCTCGAGGATAGTCACGATTTCCAGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004518.4-512s21c1
Sequence:CCGGTTTCCACCATCAAGGAGTATGCTCGAGCATACTCCTTGATGGTGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004518.4-1821s21c1
Sequence:CCGGGGACATGCTGTCCCGAATTAACTCGAGTTAATTCGGGACAGCATGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004518.2-1281s1c1
Sequence:CCGGCGTGCCCATGTACAGACTTATCTCGAGATAAGTCTGTACATGGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004518.2-405s1c1
Sequence:CCGGGCTGCAGAATTTCCTCTACAACTCGAGTTGTAGAGGAAATTCTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004518.2-880s1c1
Sequence:CCGGGCCTGGTACATCGGCTTCCTTCTCGAGAAGGAAGCCGATGTACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004518.2-1989s1c1
Sequence:CCGGCATGGAGAAGAAGCTGGACTTCTCGAGAAGTCCAGCTTCTTCTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004518.2-670s1c1
Sequence:CCGGCGGAAACCGTTCTGTGTGATTCTCGAGAATCACACAGAACGGTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004518
KCNQ2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, KQT-like subfamily, member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004518.4-559s21c1
Sequence:CCGGATCCTGGAAATCGTGACTATCCTCGAGGATAGTCACGATTTCCAGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004518.4-512s21c1
Sequence:CCGGTTTCCACCATCAAGGAGTATGCTCGAGCATACTCCTTGATGGTGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004518.4-1821s21c1
Sequence:CCGGGGACATGCTGTCCCGAATTAACTCGAGTTAATTCGGGACAGCATGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004518.2-1281s1c1
Sequence:CCGGCGTGCCCATGTACAGACTTATCTCGAGATAAGTCTGTACATGGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004518.2-405s1c1
Sequence:CCGGGCTGCAGAATTTCCTCTACAACTCGAGTTGTAGAGGAAATTCTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004518.2-880s1c1
Sequence:CCGGGCCTGGTACATCGGCTTCCTTCTCGAGAAGGAAGCCGATGTACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004518.2-1989s1c1
Sequence:CCGGCATGGAGAAGAAGCTGGACTTCTCGAGAAGTCCAGCTTCTTCTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004518.2-670s1c1
Sequence:CCGGCGGAAACCGTTCTGTGTGATTCTCGAGAATCACACAGAACGGTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004518
KCNQ2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, KQT-like subfamily, member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004518.4-559s21c1
Sequence:CCGGATCCTGGAAATCGTGACTATCCTCGAGGATAGTCACGATTTCCAGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004518.4-512s21c1
Sequence:CCGGTTTCCACCATCAAGGAGTATGCTCGAGCATACTCCTTGATGGTGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004518.4-1821s21c1
Sequence:CCGGGGACATGCTGTCCCGAATTAACTCGAGTTAATTCGGGACAGCATGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004518.2-1281s1c1
Sequence:CCGGCGTGCCCATGTACAGACTTATCTCGAGATAAGTCTGTACATGGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004518.2-405s1c1
Sequence:CCGGGCTGCAGAATTTCCTCTACAACTCGAGTTGTAGAGGAAATTCTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004518.2-880s1c1
Sequence:CCGGGCCTGGTACATCGGCTTCCTTCTCGAGAAGGAAGCCGATGTACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004518.2-1989s1c1
Sequence:CCGGCATGGAGAAGAAGCTGGACTTCTCGAGAAGTCCAGCTTCTTCTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004518.2-670s1c1
Sequence:CCGGCGGAAACCGTTCTGTGTGATTCTCGAGAATCACACAGAACGGTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006674
KCNQ2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, KQT-like subfamily, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006674.1-2203s1c1
Sequence:CCGGCCAGGGAATGAACTCTAGTTTCTCGAGAAACTAGAGTTCATTCCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006674.1-1693s1c1
Sequence:CCGGGTTCTTGGTATCTAAGCGAAACTCGAGTTTCGCTTAGATACCAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006674.1-1777s1c1
Sequence:CCGGCTTGGATATGTTGTCCCGCATCTCGAGATGCGGGACAACATATCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006674.1-535s1c1
Sequence:CCGGCGTGGTATTCGGTGTTGAGTACTCGAGTACTCAACACCGAATACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006674.1-631s1c1
Sequence:CCGGGCCGTTCTGTGTGATTGATATCTCGAGATATCAATCACACAGAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006674
KCNQ2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, KQT-like subfamily, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006674.1-2203s1c1
Sequence:CCGGCCAGGGAATGAACTCTAGTTTCTCGAGAAACTAGAGTTCATTCCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006674.1-1693s1c1
Sequence:CCGGGTTCTTGGTATCTAAGCGAAACTCGAGTTTCGCTTAGATACCAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006674.1-1777s1c1
Sequence:CCGGCTTGGATATGTTGTCCCGCATCTCGAGATGCGGGACAACATATCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006674.1-535s1c1
Sequence:CCGGCGTGGTATTCGGTGTTGAGTACTCGAGTACTCAACACCGAATACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006674.1-631s1c1
Sequence:CCGGGCCGTTCTGTGTGATTGATATCTCGAGATATCAATCACACAGAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006674
KCNQ2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, KQT-like subfamily, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006674.1-2203s1c1
Sequence:CCGGCCAGGGAATGAACTCTAGTTTCTCGAGAAACTAGAGTTCATTCCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006674.1-1693s1c1
Sequence:CCGGGTTCTTGGTATCTAAGCGAAACTCGAGTTTCGCTTAGATACCAAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006674.1-1777s1c1
Sequence:CCGGCTTGGATATGTTGTCCCGCATCTCGAGATGCGGGACAACATATCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006674.1-535s1c1
Sequence:CCGGCGTGGTATTCGGTGTTGAGTACTCGAGTACTCAACACCGAATACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006674.1-631s1c1
Sequence:CCGGGCCGTTCTGTGTGATTGATATCTCGAGATATCAATCACACAGAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)