EMAIL THIS PAGE TO A FRIEND

KCNQ3

potassium voltage-gated channel, KQT-like subfamily, member 3

66 Gene Product Result for
Synonyms: BFNC2 EBN2 KV7.3
UniProtKB ID: O43525, B4DJY4, E7EQ89
Gene ID:
Human(3786) Summary: The M channel is a slowly activating and deactivating potassium channel that plays a critical role in the regulation of neuronal excitability. The M channel is formed by the association of the protein encoded by this gene and one of two related proteins encoded by the KCNQ2 and KCNQ5 genes, both integral membrane proteins. M channel currents are inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 2 (BFNC2), also known as epilepsy, benign neonatal type 2 (EBN2). Two variants encoding distinct isoforms have been found. [provided by RefSeq, Mar 2011]
Mouse(110862) potassium voltage-gated channel, subfamily Q, member 3
Rat(29682) potassium voltage-gated channel, KQT-like subfamily, member 3
Zebrafish(799747) potassium voltage-gated channel, KQT-like subfamily, member 3
cow(281884) potassium voltage-gated channel, KQT-like subfamily, member 3
Horse(100057886) potassium voltage-gated channel, KQT-like subfamily, member 3
domestic cat(101093496) potassium voltage-gated channel, KQT-like subfamily, member 3
dog(475103) potassium voltage-gated channel, KQT-like subfamily, member 3
chicken(420325) potassium voltage-gated channel, KQT-like subfamily, member 3
domestic guinea pig(100722068) potassium voltage-gated channel, KQT-like subfamily, member 3
naked mole-rat(101726081) potassium voltage-gated channel, KQT-like subfamily, member 3
sheep(101120673) potassium voltage-gated channel, KQT-like subfamily, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004519 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004519 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004519 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152923 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152923 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152923 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019611 MISSION® esiRNA esiRNA targeting human KCNQ3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004519 Rosetta Predictions human pricing
NM_031597 Rosetta Predictions rat pricing
NM_152923 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238246 predicted 2244
2 SASI_Hs01_00238247 predicted 757
3 SASI_Hs01_00238248 predicted 2862
4 SASI_Hs01_00238249 predicted 980
5 SASI_Hs01_00238250 predicted 1206
6 SASI_Hs02_00337799 predicted 1530
7 SASI_Hs01_00238252 predicted 1233
8 SASI_Hs01_00238253 predicted 719
9 SASI_Hs01_00238254 predicted 784
10 SASI_Hs02_00337800 predicted 1029
11 SASI_Hs01_00238245 predicted 1002
12 SASI_Hs01_00238251 predicted 1124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089883 predicted 1080
2 SASI_Rn01_00089884 predicted 1180
3 SASI_Rn01_00089885 predicted 1489
4 SASI_Rn01_00089886 predicted 739
5 SASI_Rn01_00089887 predicted 1239
6 SASI_Rn02_00264869 predicted 1319
7 SASI_Rn01_00089888 predicted 929
8 SASI_Rn02_00264870 predicted 1730
9 SASI_Rn01_00089890 predicted 1037
10 SASI_Rn01_00089891 predicted 3088
11 SASI_Rn01_00089889 predicted 734
12 SASI_Rn01_00089892 predicted 2445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152923 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089156 predicted 2015
2 SASI_Mm01_00089157 predicted 1964
3 SASI_Mm02_00342842 predicted 2141
4 SASI_Mm01_00089158 predicted 317
5 SASI_Mm01_00089159 predicted 810
6 SASI_Mm01_00089160 predicted 890
7 SASI_Mm01_00089161 predicted 507
8 SASI_Mm01_00089162 predicted 1940
9 SASI_Mm01_00089163 predicted 1304
10 SASI_Mm01_00089165 predicted 2248
11 SASI_Mm01_00089164 predicted 1225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004519
KCNQ3 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, KQT-like subfamily, member 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004519.2-1919s21c1
Sequence:CCGGAGACGAGAATAGATATGATTTCTCGAGAAATCATATCTATTCTCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004519.2-2867s1c1
Sequence:CCGGCCTTGTAATGTAGACAGACTTCTCGAGAAGTCTGTCTACATTACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004519.2-1564s1c1
Sequence:CCGGCCTCTGAATGTAGATGCCATACTCGAGTATGGCATCTACATTCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004519.2-1890s1c1
Sequence:CCGGCGACATGCTTTCCAGGATAAACTCGAGTTTATCCTGGAAAGCATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004519.2-2823s1c1
Sequence:CCGGCCCTTCCAATAAGCCCATTTACTCGAGTAAATGGGCTTATTGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004519.2-540s1c1
Sequence:CCGGGCGCATCCAAACTTTGATCTACTCGAGTAGATCAAAGTTTGGATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004519
KCNQ3 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, KQT-like subfamily, member 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004519.2-1919s21c1
Sequence:CCGGAGACGAGAATAGATATGATTTCTCGAGAAATCATATCTATTCTCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004519.2-2867s1c1
Sequence:CCGGCCTTGTAATGTAGACAGACTTCTCGAGAAGTCTGTCTACATTACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004519.2-1564s1c1
Sequence:CCGGCCTCTGAATGTAGATGCCATACTCGAGTATGGCATCTACATTCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004519.2-1890s1c1
Sequence:CCGGCGACATGCTTTCCAGGATAAACTCGAGTTTATCCTGGAAAGCATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004519.2-2823s1c1
Sequence:CCGGCCCTTCCAATAAGCCCATTTACTCGAGTAAATGGGCTTATTGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004519.2-540s1c1
Sequence:CCGGGCGCATCCAAACTTTGATCTACTCGAGTAGATCAAAGTTTGGATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004519
KCNQ3 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, KQT-like subfamily, member 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004519.2-1919s21c1
Sequence:CCGGAGACGAGAATAGATATGATTTCTCGAGAAATCATATCTATTCTCGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004519.2-2867s1c1
Sequence:CCGGCCTTGTAATGTAGACAGACTTCTCGAGAAGTCTGTCTACATTACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004519.2-1564s1c1
Sequence:CCGGCCTCTGAATGTAGATGCCATACTCGAGTATGGCATCTACATTCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004519.2-1890s1c1
Sequence:CCGGCGACATGCTTTCCAGGATAAACTCGAGTTTATCCTGGAAAGCATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004519.2-2823s1c1
Sequence:CCGGCCCTTCCAATAAGCCCATTTACTCGAGTAAATGGGCTTATTGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004519.2-540s1c1
Sequence:CCGGGCGCATCCAAACTTTGATCTACTCGAGTAGATCAAAGTTTGGATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152923
KCNQ3 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, KQT-like subfamily, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152923.1-474s1c1
Sequence:CCGGGCTGCTGGAAACCTTTGCTATCTCGAGATAGCAAAGGTTTCCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152923.1-2176s1c1
Sequence:CCGGCCCAGTTCTACAAAGGCTCAACTCGAGTTGAGCCTTTGTAGAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152923.1-594s1c1
Sequence:CCGGCCTGTGCATGTTGGACATCTTCTCGAGAAGATGTCCAACATGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152923.1-1692s1c1
Sequence:CCGGCCTACAGACAAGAATAGATATCTCGAGATATCTATTCTTGTCTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152923.1-1658s1c1
Sequence:CCGGCCGGACATCTTGACATGCTTTCTCGAGAAAGCATGTCAAGATGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152923
KCNQ3 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, KQT-like subfamily, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152923.1-474s1c1
Sequence:CCGGGCTGCTGGAAACCTTTGCTATCTCGAGATAGCAAAGGTTTCCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152923.1-2176s1c1
Sequence:CCGGCCCAGTTCTACAAAGGCTCAACTCGAGTTGAGCCTTTGTAGAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152923.1-594s1c1
Sequence:CCGGCCTGTGCATGTTGGACATCTTCTCGAGAAGATGTCCAACATGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152923.1-1692s1c1
Sequence:CCGGCCTACAGACAAGAATAGATATCTCGAGATATCTATTCTTGTCTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152923.1-1658s1c1
Sequence:CCGGCCGGACATCTTGACATGCTTTCTCGAGAAAGCATGTCAAGATGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152923
KCNQ3 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, KQT-like subfamily, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152923.1-474s1c1
Sequence:CCGGGCTGCTGGAAACCTTTGCTATCTCGAGATAGCAAAGGTTTCCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152923.1-2176s1c1
Sequence:CCGGCCCAGTTCTACAAAGGCTCAACTCGAGTTGAGCCTTTGTAGAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152923.1-594s1c1
Sequence:CCGGCCTGTGCATGTTGGACATCTTCTCGAGAAGATGTCCAACATGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152923.1-1692s1c1
Sequence:CCGGCCTACAGACAAGAATAGATATCTCGAGATATCTATTCTTGTCTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152923.1-1658s1c1
Sequence:CCGGCCGGACATCTTGACATGCTTTCTCGAGAAAGCATGTCAAGATGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)