EMAIL THIS PAGE TO A FRIEND

KCNQ4

potassium voltage-gated channel, KQT-like subfamily, member 4

93 Gene Product Result for
Synonyms: DFNA2 DFNA2A KV7.4
UniProtKB ID: P56696, O96025
Gene ID:
Human(9132) Summary: The protein encoded by this gene forms a potassium channel that is thought to play a critical role in the regulation of neuronal excitability, particularly in sensory cells of the cochlea. The current generated by this channel is inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. The encoded protein can form a homomultimeric potassium channel or possibly a heteromultimeric channel in association with the protein encoded by the KCNQ3 gene. Defects in this gene are a cause of nonsyndromic sensorineural deafness type 2 (DFNA2), an autosomal dominant form of progressive hearing loss. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(60613) potassium voltage-gated channel, subfamily Q, member 4
Rat(298496) potassium voltage-gated channel, KQT-like subfamily, member 4
sheep(101122655) potassium voltage-gated channel, KQT-like subfamily, member 4
Domestic Rabbit(100358271) potassium voltage-gated channel, KQT-like subfamily, member 4
domestic guinea pig(100716024) potassium voltage-gated channel, KQT-like subfamily, member 4
naked mole-rat(101714294) potassium voltage-gated channel, KQT-like subfamily, member 4
chicken(419643) potassium voltage-gated channel, KQT-like subfamily, member 4
domestic cat(101091641) potassium voltage-gated channel, KQT-like subfamily, member 4
Horse(100067963) potassium voltage-gated channel, KQT-like subfamily, member 4
cow(528741) potassium voltage-gated channel, KQT-like subfamily, member 4
dog(482451) potassium voltage-gated channel, KQT-like subfamily, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
E3876 N-Ethylmaleimide crystalline, ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004700 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_143960 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_143960 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_143960 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004700 Rosetta Predictions human pricing
NM_172163 Rosetta Predictions human pricing
XM_001053765 Rosetta Predictions rat pricing
XM_233477 Rosetta Predictions rat pricing
NM_001081142 Rosetta Predictions mouse pricing
XM_143960 Rosetta Predictions mouse pricing
XM_900381 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091677 predicted 470
2 SASI_Hs01_00091679 predicted 987
3 SASI_Hs02_00338149 predicted 1816
4 SASI_Hs01_00091680 predicted 792
5 SASI_Hs01_00091681 predicted 1739
6 SASI_Hs01_00091682 predicted 447
7 SASI_Hs01_00091683 predicted 1802
8 SASI_Hs01_00091684 predicted 907
9 SASI_Hs01_00091685 predicted 1676
10 SASI_Hs01_00091686 predicted 926
11 SASI_Hs01_00091678 predicted 1654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215777 predicted 471
2 SASI_Hs01_00215779 predicted 984
3 SASI_Hs02_00367858 predicted 1653
4 SASI_Hs01_00215780 predicted 790
5 SASI_Hs01_00215781 predicted 1582
6 SASI_Hs01_00215782 predicted 454
7 SASI_Hs01_00215783 predicted 1639
8 SASI_Hs01_00215784 predicted 909
9 SASI_Hs01_00215785 predicted 1513
10 SASI_Hs01_00215786 predicted 933
11 SASI_Hs01_00215778 predicted 1489
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053765 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273482 predicted 1066
2 SASI_Rn02_00273483 predicted 1624
3 SASI_Rn02_00273484 predicted 349
4 SASI_Rn02_00273485 predicted 1753
5 SASI_Rn02_00273486 predicted 1278
6 SASI_Rn02_00273487 predicted 793
7 SASI_Rn02_00273488 predicted 1050
8 SASI_Rn02_00273489 predicted 1606
9 SASI_Rn02_00273490 predicted 871
10 SASI_Rn02_00273491 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233477 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387804 predicted 1208
2 SASI_Rn02_00387805 predicted 1761
3 SASI_Rn02_00387806 predicted 497
4 SASI_Rn02_00387807 predicted 1900
5 SASI_Rn02_00387808 predicted 1421
6 SASI_Rn02_00387809 predicted 929
7 SASI_Rn02_00387810 predicted 1198
8 SASI_Rn02_00387811 predicted 1754
9 SASI_Rn02_00387812 predicted 1011
10 SASI_Rn02_00387813 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295591 predicted 707
2 SASI_Mm02_00295592 predicted 1665
3 SASI_Mm02_00295593 predicted 606
4 SASI_Mm02_00295594 predicted 1067
5 SASI_Mm02_00295595 predicted 399
6 SASI_Mm02_00295596 predicted 1796
7 SASI_Mm02_00295597 predicted 1094
8 SASI_Mm02_00295598 predicted 912
9 SASI_Mm02_00295599 predicted 868
10 SASI_Mm02_00295600 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_143960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278533 predicted 429
2 SASI_Mm01_00278534 predicted 711
3 SASI_Mm01_00278535 predicted 1665
4 SASI_Mm01_00278536 predicted 1074
5 SASI_Mm01_00278537 predicted 399
6 SASI_Mm01_00278538 predicted 1805
7 SASI_Mm01_00278539 predicted 1103
8 SASI_Mm01_00278540 predicted 915
9 SASI_Mm01_00278541 predicted 875
10 SASI_Mm01_00278542 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00282133 predicted 506
2 SASI_Mm01_00282134 predicted 1351
3 SASI_Mm01_00282135 predicted 853
4 SASI_Mm01_00282136 predicted 1489
5 SASI_Mm01_00282137 predicted 892
6 SASI_Mm01_00282138 predicted 697
7 SASI_Mm01_00282139 predicted 658
8 SASI_Mm01_00282140 predicted 362
9 SASI_Mm01_00282141 predicted 917
10 SASI_Mm01_00282142 predicted 891
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004700
KCNQ4 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, KQT-like subfamily, member 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004700.2-1445s21c1
Sequence:CCGGCATCTGGCACCTCCAACAATGCTCGAGCATTGTTGGAGGTGCCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004700.2-1909s21c1
Sequence:CCGGGGTGGATGAAATCAGCATGATCTCGAGATCATGCTGATTTCATCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004700.2-456s21c1
Sequence:CCGGAGGAACTTGCCAACGAGTGTCCTCGAGGACACTCGTTGGCAAGTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004700.2-1132s1c1
Sequence:CCGGGCGCCTGTACTCCACCGATATCTCGAGATATCGGTGGAGTACAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004700.2-380s1c1
Sequence:CCGGGTCTACCACGTCTTCATATTTCTCGAGAAATATGAAGACGTGGTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004700.2-1687s1c1
Sequence:CCGGCTCCATCAGGATTCTCAAGTTCTCGAGAACTTGAGAATCCTGATGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004700.2-1803s1c1
Sequence:CCGGGCCGGATCAAGAGCCTGCAAACTCGAGTTTGCAGGCTCTTGATCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004700.2-1177s1c1
Sequence:CCGGCTGGTACTACTATGACAGTATCTCGAGATACTGTCATAGTAGTACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004700
KCNQ4 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, KQT-like subfamily, member 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004700.2-1445s21c1
Sequence:CCGGCATCTGGCACCTCCAACAATGCTCGAGCATTGTTGGAGGTGCCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004700.2-1909s21c1
Sequence:CCGGGGTGGATGAAATCAGCATGATCTCGAGATCATGCTGATTTCATCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004700.2-456s21c1
Sequence:CCGGAGGAACTTGCCAACGAGTGTCCTCGAGGACACTCGTTGGCAAGTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004700.2-1132s1c1
Sequence:CCGGGCGCCTGTACTCCACCGATATCTCGAGATATCGGTGGAGTACAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004700.2-380s1c1
Sequence:CCGGGTCTACCACGTCTTCATATTTCTCGAGAAATATGAAGACGTGGTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004700.2-1687s1c1
Sequence:CCGGCTCCATCAGGATTCTCAAGTTCTCGAGAACTTGAGAATCCTGATGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004700.2-1803s1c1
Sequence:CCGGGCCGGATCAAGAGCCTGCAAACTCGAGTTTGCAGGCTCTTGATCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004700.2-1177s1c1
Sequence:CCGGCTGGTACTACTATGACAGTATCTCGAGATACTGTCATAGTAGTACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004700
KCNQ4 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, KQT-like subfamily, member 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004700.2-1445s21c1
Sequence:CCGGCATCTGGCACCTCCAACAATGCTCGAGCATTGTTGGAGGTGCCAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004700.2-1909s21c1
Sequence:CCGGGGTGGATGAAATCAGCATGATCTCGAGATCATGCTGATTTCATCCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004700.2-456s21c1
Sequence:CCGGAGGAACTTGCCAACGAGTGTCCTCGAGGACACTCGTTGGCAAGTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004700.2-1132s1c1
Sequence:CCGGGCGCCTGTACTCCACCGATATCTCGAGATATCGGTGGAGTACAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004700.2-380s1c1
Sequence:CCGGGTCTACCACGTCTTCATATTTCTCGAGAAATATGAAGACGTGGTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004700.2-1687s1c1
Sequence:CCGGCTCCATCAGGATTCTCAAGTTCTCGAGAACTTGAGAATCCTGATGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004700.2-1803s1c1
Sequence:CCGGGCCGGATCAAGAGCCTGCAAACTCGAGTTTGCAGGCTCTTGATCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004700.2-1177s1c1
Sequence:CCGGCTGGTACTACTATGACAGTATCTCGAGATACTGTCATAGTAGTACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_143960
KCNQ4 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, KQT-like subfamily, member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143960.4-393s1c1
Sequence:CCGGGTGTCTCCTTATCTTGGAATTCTCGAGAATTCCAAGATAAGGAGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143960.4-1141s1c1
Sequence:CCGGGCCCTCTTGTTTGAGCACATACTCGAGTATGTGCTCAAACAAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143960.4-1605s1c1
Sequence:CCGGCCGTTCTGTCAGGATTCTGAACTCGAGTTCAGAATCCTGACAGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143960.4-1881s1c1
Sequence:CCGGGCAGTCCATCGAACATAAGTTCTCGAGAACTTATGTTCGATGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143960.4-1302s1c1
Sequence:CCGGGATGGGCATCAAAGACCGAATCTCGAGATTCGGTCTTTGATGCCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_143960
KCNQ4 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, KQT-like subfamily, member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143960.4-393s1c1
Sequence:CCGGGTGTCTCCTTATCTTGGAATTCTCGAGAATTCCAAGATAAGGAGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143960.4-1141s1c1
Sequence:CCGGGCCCTCTTGTTTGAGCACATACTCGAGTATGTGCTCAAACAAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143960.4-1605s1c1
Sequence:CCGGCCGTTCTGTCAGGATTCTGAACTCGAGTTCAGAATCCTGACAGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143960.4-1881s1c1
Sequence:CCGGGCAGTCCATCGAACATAAGTTCTCGAGAACTTATGTTCGATGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143960.4-1302s1c1
Sequence:CCGGGATGGGCATCAAAGACCGAATCTCGAGATTCGGTCTTTGATGCCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_143960
KCNQ4 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, KQT-like subfamily, member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143960.4-393s1c1
Sequence:CCGGGTGTCTCCTTATCTTGGAATTCTCGAGAATTCCAAGATAAGGAGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143960.4-1141s1c1
Sequence:CCGGGCCCTCTTGTTTGAGCACATACTCGAGTATGTGCTCAAACAAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143960.4-1605s1c1
Sequence:CCGGCCGTTCTGTCAGGATTCTGAACTCGAGTTCAGAATCCTGACAGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143960.4-1881s1c1
Sequence:CCGGGCAGTCCATCGAACATAAGTTCTCGAGAACTTATGTTCGATGGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143960.4-1302s1c1
Sequence:CCGGGATGGGCATCAAAGACCGAATCTCGAGATTCGGTCTTTGATGCCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)