EMAIL THIS PAGE TO A FRIEND

KCNQ5

potassium voltage-gated channel, KQT-like subfamily, member 5

97 Gene Product Result for
Synonyms: Kv7.5
Gene ID:
Human(56479) Summary: This gene is a member of the KCNQ potassium channel gene family that is differentially expressed in subregions of the brain and in skeletal muscle. The protein encoded by this gene yields currents that activate slowly with depolarization and can form heteromeric channels with the protein encoded by the KCNQ3 gene. Currents expressed from this protein have voltage dependences and inhibitor sensitivities in common with M-currents. They are also inhibited by M1 muscarinic receptor activation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Mouse(226922) potassium voltage-gated channel, subfamily Q, member 5
Rat(259273) potassium voltage-gated channel, KQT-like subfamily, member 5
chicken(421866) potassium voltage-gated channel, KQT-like subfamily, member 5
cow(613605) potassium voltage-gated channel, KQT-like subfamily, member 5
Horse(100071357) potassium voltage-gated channel, KQT-like subfamily, member 5
domestic cat(101092113) potassium voltage-gated channel, KQT-like subfamily, member 5
dog(474965) potassium voltage-gated channel, KQT-like subfamily, member 5
domestic guinea pig(100721474) potassium voltage-gated channel, KQT-like subfamily, member 5
naked mole-rat(101704304) potassium voltage-gated channel, KQT-like subfamily, member 5
sheep(100174987) potassium voltage-gated channel, KQT-like subfamily, member 5
Domestic Rabbit(100328657) potassium voltage-gated channel, KQT-like subfamily, member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
E3876 N-Ethylmaleimide crystalline, ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019842 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019842 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019842 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_129704 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_129704 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_129704 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019842 Rosetta Predictions human pricing
XM_001069745 Rosetta Predictions rat pricing
XM_001071249 Rosetta Predictions rat pricing
NM_023872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228174 predicted 2562
2 SASI_Hs01_00228175 predicted 2102
3 SASI_Hs01_00228176 predicted 867
4 SASI_Hs01_00228177 predicted 2511
5 SASI_Hs01_00228178 predicted 2145
6 SASI_Hs01_00228179 predicted 1853
7 SASI_Hs01_00228180 predicted 1821
8 SASI_Hs01_00228181 predicted 2222
9 SASI_Hs01_00228183 predicted 2399
10 SASI_Hs02_00352851 predicted 2173
11 SASI_Hs01_00228182 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069745 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329130 predicted 462
2 SASI_Rn02_00329131 predicted 456
3 SASI_Rn02_00329132 predicted 380
4 SASI_Rn02_00329133 predicted 474
5 SASI_Rn02_00329134 predicted 390
6 SASI_Rn02_00329135 predicted 558
7 SASI_Rn02_00329136 predicted 387
8 SASI_Rn02_00329137 predicted 575
9 SASI_Rn02_00329138 predicted 467
10 SASI_Rn02_00329139 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334347 predicted 1816
2 SASI_Rn02_00334348 predicted 1072
3 SASI_Rn02_00334349 predicted 939
4 SASI_Rn02_00334350 predicted 2996
5 SASI_Rn02_00334351 predicted 1629
6 SASI_Rn02_00334352 predicted 2749
7 SASI_Rn02_00334353 predicted 1768
8 SASI_Rn02_00334354 predicted 2240
9 SASI_Rn02_00334355 predicted 2627
10 SASI_Rn02_00334356 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327417 predicted 924
2 SASI_Mm01_00044963 predicted 1730
3 SASI_Mm01_00044966 predicted 1136
4 SASI_Mm01_00044967 predicted 602
5 SASI_Mm02_00327418 predicted 1613
6 SASI_Mm01_00044968 predicted 2076
7 SASI_Mm01_00044969 predicted 1741
8 SASI_Mm01_00044970 predicted 461
9 SASI_Mm01_00044971 predicted 1185
10 SASI_Mm01_00044972 predicted 2476
11 SASI_Mm01_00044964 predicted 797
12 SASI_Mm01_00044965 predicted 936
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019842
VALIDATED
KCNQ5 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, KQT-like subfamily, member 5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019842.3-2489s21c1
Sequence:CCGGACAGGTGCCAATTAGTCAAAGCTCGAGCTTTGACTAATTGGCACCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019842.2-2394s1c1
Sequence:CCGGGCAGGCTTACAGGAAAGCATTCTCGAGAATGCTTTCCTGTAAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019842.2-1195s1c1
Sequence:CCGGCCAACCTCATTCAGTGTGTTTCTCGAGAAACACACTGAATGAGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019842.2-1686s1c1
Sequence:CCGGCGGAAGTTTAAGGAAACATTACTCGAGTAATGTTTCCTTAAACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019842.2-2773s1c1
Sequence:CCGGCCTTTGCATCAGACTCTCTAACTCGAGTTAGAGAGTCTGATGCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019842.2-2147s1c1
Sequence:CCGGGCAGTTCATTCTGACGCCAAACTCGAGTTTGGCGTCAGAATGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019842.3-3583s21c1
Sequence:CCGGGCTAATAAGGTATCAACTAAACTCGAGTTTAGTTGATACCTTATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019842
VALIDATED
KCNQ5 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, KQT-like subfamily, member 5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019842.3-2489s21c1
Sequence:CCGGACAGGTGCCAATTAGTCAAAGCTCGAGCTTTGACTAATTGGCACCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019842.2-2394s1c1
Sequence:CCGGGCAGGCTTACAGGAAAGCATTCTCGAGAATGCTTTCCTGTAAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019842.2-1195s1c1
Sequence:CCGGCCAACCTCATTCAGTGTGTTTCTCGAGAAACACACTGAATGAGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019842.2-1686s1c1
Sequence:CCGGCGGAAGTTTAAGGAAACATTACTCGAGTAATGTTTCCTTAAACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019842.2-2773s1c1
Sequence:CCGGCCTTTGCATCAGACTCTCTAACTCGAGTTAGAGAGTCTGATGCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019842.2-2147s1c1
Sequence:CCGGGCAGTTCATTCTGACGCCAAACTCGAGTTTGGCGTCAGAATGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019842.3-3583s21c1
Sequence:CCGGGCTAATAAGGTATCAACTAAACTCGAGTTTAGTTGATACCTTATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019842
VALIDATED
KCNQ5 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, KQT-like subfamily, member 5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019842.3-2489s21c1
Sequence:CCGGACAGGTGCCAATTAGTCAAAGCTCGAGCTTTGACTAATTGGCACCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019842.2-2394s1c1
Sequence:CCGGGCAGGCTTACAGGAAAGCATTCTCGAGAATGCTTTCCTGTAAGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019842.2-1195s1c1
Sequence:CCGGCCAACCTCATTCAGTGTGTTTCTCGAGAAACACACTGAATGAGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019842.2-1686s1c1
Sequence:CCGGCGGAAGTTTAAGGAAACATTACTCGAGTAATGTTTCCTTAAACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019842.2-2773s1c1
Sequence:CCGGCCTTTGCATCAGACTCTCTAACTCGAGTTAGAGAGTCTGATGCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_019842.2-2147s1c1
Sequence:CCGGGCAGTTCATTCTGACGCCAAACTCGAGTTTGGCGTCAGAATGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019842.3-3583s21c1
Sequence:CCGGGCTAATAAGGTATCAACTAAACTCGAGTTTAGTTGATACCTTATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_129704
KCNQ5 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, KQT-like subfamily, member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129704.4-1377s1c1
Sequence:CCGGGCCTCACGTCAAACTGAACTACTCGAGTAGTTCAGTTTGACGTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129704.4-412s1c1
Sequence:CCGGCGGGTTGTGAAGGTTGAGAAACTCGAGTTTCTCAACCTTCACAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129704.4-1322s1c1
Sequence:CCGGCACGGTCATCTCAGAACATTTCTCGAGAAATGTTCTGAGATGACCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129704.4-911s1c1
Sequence:CCGGCCGGCTTACAAGAGAGTATTTCTCGAGAAATACTCTCTTGTAAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129704.4-309s1c1
Sequence:CCGGCGTTGATCAAATTCTTGGAAACTCGAGTTTCCAAGAATTTGATCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_129704
KCNQ5 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, KQT-like subfamily, member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129704.4-1377s1c1
Sequence:CCGGGCCTCACGTCAAACTGAACTACTCGAGTAGTTCAGTTTGACGTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129704.4-412s1c1
Sequence:CCGGCGGGTTGTGAAGGTTGAGAAACTCGAGTTTCTCAACCTTCACAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129704.4-1322s1c1
Sequence:CCGGCACGGTCATCTCAGAACATTTCTCGAGAAATGTTCTGAGATGACCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129704.4-911s1c1
Sequence:CCGGCCGGCTTACAAGAGAGTATTTCTCGAGAAATACTCTCTTGTAAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129704.4-309s1c1
Sequence:CCGGCGTTGATCAAATTCTTGGAAACTCGAGTTTCCAAGAATTTGATCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_129704
KCNQ5 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, KQT-like subfamily, member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129704.4-1377s1c1
Sequence:CCGGGCCTCACGTCAAACTGAACTACTCGAGTAGTTCAGTTTGACGTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129704.4-412s1c1
Sequence:CCGGCGGGTTGTGAAGGTTGAGAAACTCGAGTTTCTCAACCTTCACAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129704.4-1322s1c1
Sequence:CCGGCACGGTCATCTCAGAACATTTCTCGAGAAATGTTCTGAGATGACCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129704.4-911s1c1
Sequence:CCGGCCGGCTTACAAGAGAGTATTTCTCGAGAAATACTCTCTTGTAAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129704.4-309s1c1
Sequence:CCGGCGTTGATCAAATTCTTGGAAACTCGAGTTTCCAAGAATTTGATCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)