EMAIL THIS PAGE TO A FRIEND

KCNRG

potassium channel regulator

99 Gene Product Result for
Synonyms: DLTET
UniProtKB ID: Q8N5I3, A2A2X9, Q0P6D0, Q8IU75, Q8N3Q9
Gene ID:
Human(283518) Summary: This gene encodes a protein which regulates the activity of voltage-gated potassium channels. This gene is on chromosome 13 and overlaps the gene for tripartite motif containing 13 on the same strand. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(328424) potassium channel regulator
Rat(305947) potassium channel regulator
chicken(418873) potassium channel regulator
dog(607835) potassium channel regulator
domestic cat(101092982) potassium channel regulator
cow(404166) potassium channel regulator
sheep(101118623) potassium channel regulator
domestic guinea pig(100719078) potassium channel regulator
naked mole-rat(101697220) potassium channel regulator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173605 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173605 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173605 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_206974 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_206974 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_206974 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173605 Rosetta Predictions human pricing
NM_199464 Rosetta Predictions human pricing
XM_001063795 Rosetta Predictions rat pricing
XM_224261 Rosetta Predictions rat pricing
NM_001039105 Rosetta Predictions mouse pricing
NM_206974 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101737 predicted 554
2 SASI_Hs01_00101739 predicted 460
3 SASI_Hs02_00368465 predicted 401
4 SASI_Hs01_00101741 predicted 269
5 SASI_Hs02_00368466 predicted 1030
6 SASI_Hs02_00368467 predicted 1032
7 SASI_Hs01_00101742 predicted 536
8 SASI_Hs01_00101743 predicted 395
9 SASI_Hs01_00101744 predicted 393
10 SASI_Hs01_00101745 predicted 463
11 SASI_Hs01_00101738 predicted 499
12 SASI_Hs01_00101740 predicted 317
13 SASI_Hs01_00101746 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033189 predicted 556
2 SASI_Hs01_00033191 predicted 462
3 SASI_Hs02_00372869 predicted 403
4 SASI_Hs01_00033193 predicted 275
5 SASI_Hs02_00372870 predicted 1127
6 SASI_Hs02_00372871 predicted 1133
7 SASI_Hs01_00033194 predicted 535
8 SASI_Hs01_00033195 predicted 397
9 SASI_Hs01_00033196 predicted 393
10 SASI_Hs01_00033197 predicted 466
11 SASI_Hs01_00033190 predicted 506
12 SASI_Hs01_00033192 predicted 309
13 SASI_Hs01_00033198 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063795 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308345 predicted 301
2 SASI_Rn02_00308346 predicted 533
3 SASI_Rn02_00308347 predicted 335
4 SASI_Rn02_00308348 predicted 409
5 SASI_Rn02_00308349 predicted 403
6 SASI_Rn02_00308350 predicted 376
7 SASI_Rn02_00308351 predicted 329
8 SASI_Rn02_00308352 predicted 308
9 SASI_Rn02_00308353 predicted 202
10 SASI_Rn02_00308354 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224261 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381869 predicted 305
2 SASI_Rn02_00381870 predicted 526
3 SASI_Rn02_00381871 predicted 335
4 SASI_Rn02_00381872 predicted 405
5 SASI_Rn02_00381873 predicted 406
6 SASI_Rn02_00381874 predicted 376
7 SASI_Rn02_00381875 predicted 327
8 SASI_Rn02_00381876 predicted 301
9 SASI_Rn02_00381877 predicted 204
10 SASI_Rn02_00381878 predicted 556
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039105 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025052 predicted 299
2 SASI_Mm01_00025053 predicted 358
3 SASI_Mm01_00025054 predicted 249
4 SASI_Mm01_00025055 predicted 325
5 SASI_Mm01_00025056 predicted 318
6 SASI_Mm01_00025057 predicted 240
7 SASI_Mm01_00025058 predicted 292
8 SASI_Mm01_00025059 predicted 349
9 SASI_Mm01_00025060 predicted 352
10 SASI_Mm01_00025061 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159237 predicted 319
2 SASI_Mm01_00159238 predicted 383
3 SASI_Mm01_00159239 predicted 265
4 SASI_Mm01_00159240 predicted 350
5 SASI_Mm01_00159241 predicted 349
6 SASI_Mm01_00159242 predicted 257
7 SASI_Mm01_00159243 predicted 316
8 SASI_Mm01_00159244 predicted 374
9 SASI_Mm01_00159245 predicted 378
10 SASI_Mm01_00159246 predicted 372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173605
KCNRG MISSION shRNA Bacterial Glycerol Stock
potassium channel regulator
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173605.1-1033s21c1
Sequence:CCGGCCAGAGCAATCTCAGATAAAGCTCGAGCTTTATCTGAGATTGCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173605.1-813s21c1
Sequence:CCGGAGTCAGGTATGTTTCTATAAACTCGAGTTTATAGAAACATACCTGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173605.1-919s21c1
Sequence:CCGGAGCACTAGAACAGTATCTTCTCTCGAGAGAAGATACTGTTCTAGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173605.1-1247s21c1
Sequence:CCCGGTACTTGGTGCTTTGGTATATCTCGAGATATACCAAAGCACCAAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173605.1-875s1c1
Sequence:CCGGGCTTACTGATTGACACTTTATCTCGAGATAAAGTGTCAATCAGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173605.1-982s1c1
Sequence:CCGGCCTGAAGTGCTCATCACGAATCTCGAGATTCGTGATGAGCACTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173605.1-514s1c1
Sequence:CCGGCGTTCTCTAGTTGATCTCTTACTCGAGTAAGAGATCAACTAGAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173605
KCNRG MISSION shRNA shRNA Plasmid DNA
potassium channel regulator
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173605.1-1033s21c1
Sequence:CCGGCCAGAGCAATCTCAGATAAAGCTCGAGCTTTATCTGAGATTGCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173605.1-813s21c1
Sequence:CCGGAGTCAGGTATGTTTCTATAAACTCGAGTTTATAGAAACATACCTGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173605.1-919s21c1
Sequence:CCGGAGCACTAGAACAGTATCTTCTCTCGAGAGAAGATACTGTTCTAGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173605.1-1247s21c1
Sequence:CCCGGTACTTGGTGCTTTGGTATATCTCGAGATATACCAAAGCACCAAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173605.1-875s1c1
Sequence:CCGGGCTTACTGATTGACACTTTATCTCGAGATAAAGTGTCAATCAGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173605.1-982s1c1
Sequence:CCGGCCTGAAGTGCTCATCACGAATCTCGAGATTCGTGATGAGCACTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173605.1-514s1c1
Sequence:CCGGCGTTCTCTAGTTGATCTCTTACTCGAGTAAGAGATCAACTAGAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173605
KCNRG MISSION shRNA Lentiviral Transduction Particles
potassium channel regulator
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173605.1-1033s21c1
Sequence:CCGGCCAGAGCAATCTCAGATAAAGCTCGAGCTTTATCTGAGATTGCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173605.1-813s21c1
Sequence:CCGGAGTCAGGTATGTTTCTATAAACTCGAGTTTATAGAAACATACCTGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173605.1-919s21c1
Sequence:CCGGAGCACTAGAACAGTATCTTCTCTCGAGAGAAGATACTGTTCTAGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173605.1-1247s21c1
Sequence:CCCGGTACTTGGTGCTTTGGTATATCTCGAGATATACCAAAGCACCAAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173605.1-875s1c1
Sequence:CCGGGCTTACTGATTGACACTTTATCTCGAGATAAAGTGTCAATCAGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173605.1-982s1c1
Sequence:CCGGCCTGAAGTGCTCATCACGAATCTCGAGATTCGTGATGAGCACTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173605.1-514s1c1
Sequence:CCGGCGTTCTCTAGTTGATCTCTTACTCGAGTAAGAGATCAACTAGAGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206974
KCNRG MISSION shRNA Bacterial Glycerol Stock
potassium channel regulator
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206974.1-457s1c1
Sequence:CCGGAGATGCTAAGTGGGAGGATTACTCGAGTAATCCTCCCACTTAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206974.1-277s1c1
Sequence:CCGGCGGACTTTGCAGACCATCATACTCGAGTATGATGGTCTGCAAAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206974.1-526s1c1
Sequence:CCGGCTCTGGCTTTACCTCCACAAACTCGAGTTTGTGGAGGTAAAGCCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206974.1-91s1c1
Sequence:CCGGGAGGGAGGATATTCACAACAACTCGAGTTGTTGTGAATATCCTCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206974.1-387s1c1
Sequence:CCGGGAGGTCCATTTCCTAAACCAACTCGAGTTGGTTTAGGAAATGGACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206974
KCNRG MISSION shRNA shRNA Plasmid DNA
potassium channel regulator
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206974.1-457s1c1
Sequence:CCGGAGATGCTAAGTGGGAGGATTACTCGAGTAATCCTCCCACTTAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206974.1-277s1c1
Sequence:CCGGCGGACTTTGCAGACCATCATACTCGAGTATGATGGTCTGCAAAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206974.1-526s1c1
Sequence:CCGGCTCTGGCTTTACCTCCACAAACTCGAGTTTGTGGAGGTAAAGCCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206974.1-91s1c1
Sequence:CCGGGAGGGAGGATATTCACAACAACTCGAGTTGTTGTGAATATCCTCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206974.1-387s1c1
Sequence:CCGGGAGGTCCATTTCCTAAACCAACTCGAGTTGGTTTAGGAAATGGACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206974
KCNRG MISSION shRNA Lentiviral Transduction Particles
potassium channel regulator
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206974.1-457s1c1
Sequence:CCGGAGATGCTAAGTGGGAGGATTACTCGAGTAATCCTCCCACTTAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206974.1-277s1c1
Sequence:CCGGCGGACTTTGCAGACCATCATACTCGAGTATGATGGTCTGCAAAGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206974.1-526s1c1
Sequence:CCGGCTCTGGCTTTACCTCCACAAACTCGAGTTTGTGGAGGTAAAGCCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206974.1-91s1c1
Sequence:CCGGGAGGGAGGATATTCACAACAACTCGAGTTGTTGTGAATATCCTCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206974.1-387s1c1
Sequence:CCGGGAGGTCCATTTCCTAAACCAACTCGAGTTGGTTTAGGAAATGGACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)