EMAIL THIS PAGE TO A FRIEND

KCNS1

potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1

47 Gene Product Result for
Synonyms: KV9.1
UniProtKB ID: Q96KK3, A2RUL9, B7ZM31, O43652, Q6DJU6
Gene ID:
Human(3787) Summary: Voltage-gated potassium channels form the largest and most diversified class of ion channels and are present in both excitable and nonexcitable cells. Their main functions are associated with the regulation of the resting membrane potential and the control of the shape and frequency of action potentials. The alpha subunits are of 2 types: those that are functional by themselves and those that are electrically silent but capable of modulating the activity of specific functional alpha subunits. The protein encoded by this gene is not functional by itself but can form heteromultimers with member 1 and with member 2 (and possibly other members) of the Shab-related subfamily of potassium voltage-gated channel proteins. This gene belongs to the S subfamily of the potassium channel family. [provided by RefSeq, Jul 2008]
Mouse(16538) K+ voltage-gated channel, subfamily S, 1
Rat(117023) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1
domestic guinea pig(101787272) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1
naked mole-rat(101703660) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1
sheep(101107887) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1
chicken(770173) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1
domestic cat(101089684) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1
cow(521338) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1
dog(485889) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101231 Anti-KCNS1 antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2106354 Anti-KCNS1 antibody produced in rabbit affinity isolated antibody human
western blot pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
T154 Tityustoxin-Kα from Tityus serrulatus (Brazilian scorpion) venom lyophilized powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002251 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002251 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002251 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008435 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008435 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008435 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002251 Rosetta Predictions human pricing
NM_053954 Rosetta Predictions rat pricing
NM_008435 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109958 predicted 2058
2 SASI_Hs01_00109959 predicted 1273
3 SASI_Hs01_00109960 predicted 1033
4 SASI_Hs01_00109961 predicted 1278
5 SASI_Hs01_00109962 predicted 1429
6 SASI_Hs01_00109963 predicted 1674
7 SASI_Hs01_00109964 predicted 2069
8 SASI_Hs01_00109965 predicted 1909
9 SASI_Hs01_00109966 predicted 2078
10 SASI_Hs01_00109967 predicted 1814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053954 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088708 predicted 1951
2 SASI_Rn01_00088709 predicted 1895
3 SASI_Rn01_00088710 predicted 2179
4 SASI_Rn01_00088711 predicted 1600
5 SASI_Rn01_00088712 predicted 2119
6 SASI_Rn01_00088713 predicted 772
7 SASI_Rn01_00088714 predicted 1323
8 SASI_Rn01_00088715 predicted 1862
9 SASI_Rn01_00088716 predicted 2141
10 SASI_Rn01_00088717 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133222 predicted 855
2 SASI_Mm01_00133223 predicted 835
3 SASI_Mm01_00133225 predicted 1482
4 SASI_Mm02_00313909 predicted 1866
5 SASI_Mm01_00133226 predicted 527
6 SASI_Mm01_00133227 predicted 1242
7 SASI_Mm01_00133229 predicted 1245
8 SASI_Mm01_00133230 predicted 1685
9 SASI_Mm01_00133231 predicted 514
10 SASI_Mm02_00313910 predicted 1810
11 SASI_Mm01_00133224 predicted 1359
12 SASI_Mm01_00133228 predicted 1615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002251
KCNS1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002251.3-2131s21c1
Sequence:CCGGGGACAGTGCTACCCTAGATTCCTCGAGGAATCTAGGGTAGCACTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002251.3-2232s21c1
Sequence:CCGGGGAAGTTGAAAGGATACTAATCTCGAGATTAGTATCCTTTCAACTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002251.3-427s1c1
Sequence:CCGGCTATGAGAACCTCCGGTCTAACTCGAGTTAGACCGGAGGTTCTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002251.3-1956s1c1
Sequence:CCGGCTCCACACCCTCAGATGTATTCTCGAGAATACATCTGAGGGTGTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002251.3-1847s1c1
Sequence:CCGGGACTTGCTGAGCAGCATTGATCTCGAGATCAATGCTGCTCAGCAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002251.3-484s1c1
Sequence:CCGGTGAAACCTTTGTGAGCGAGTTCTCGAGAACTCGCTCACAAAGGTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002251.3-1281s21c1
Sequence:CCGGCCAGTACGCGCAACTTCTTCTCTCGAGAGAAGAAGTTGCGCGTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002251.3-1822s1c1
Sequence:CCGGCAACAGCAACCACCAAGAGTTCTCGAGAACTCTTGGTGGTTGCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002251
KCNS1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002251.3-2131s21c1
Sequence:CCGGGGACAGTGCTACCCTAGATTCCTCGAGGAATCTAGGGTAGCACTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002251.3-2232s21c1
Sequence:CCGGGGAAGTTGAAAGGATACTAATCTCGAGATTAGTATCCTTTCAACTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002251.3-427s1c1
Sequence:CCGGCTATGAGAACCTCCGGTCTAACTCGAGTTAGACCGGAGGTTCTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002251.3-1956s1c1
Sequence:CCGGCTCCACACCCTCAGATGTATTCTCGAGAATACATCTGAGGGTGTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002251.3-1847s1c1
Sequence:CCGGGACTTGCTGAGCAGCATTGATCTCGAGATCAATGCTGCTCAGCAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002251.3-484s1c1
Sequence:CCGGTGAAACCTTTGTGAGCGAGTTCTCGAGAACTCGCTCACAAAGGTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002251.3-1281s21c1
Sequence:CCGGCCAGTACGCGCAACTTCTTCTCTCGAGAGAAGAAGTTGCGCGTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002251.3-1822s1c1
Sequence:CCGGCAACAGCAACCACCAAGAGTTCTCGAGAACTCTTGGTGGTTGCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002251
KCNS1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002251.3-2131s21c1
Sequence:CCGGGGACAGTGCTACCCTAGATTCCTCGAGGAATCTAGGGTAGCACTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002251.3-2232s21c1
Sequence:CCGGGGAAGTTGAAAGGATACTAATCTCGAGATTAGTATCCTTTCAACTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002251.3-427s1c1
Sequence:CCGGCTATGAGAACCTCCGGTCTAACTCGAGTTAGACCGGAGGTTCTCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002251.3-1956s1c1
Sequence:CCGGCTCCACACCCTCAGATGTATTCTCGAGAATACATCTGAGGGTGTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002251.3-1847s1c1
Sequence:CCGGGACTTGCTGAGCAGCATTGATCTCGAGATCAATGCTGCTCAGCAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002251.3-484s1c1
Sequence:CCGGTGAAACCTTTGTGAGCGAGTTCTCGAGAACTCGCTCACAAAGGTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002251.3-1281s21c1
Sequence:CCGGCCAGTACGCGCAACTTCTTCTCTCGAGAGAAGAAGTTGCGCGTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002251.3-1822s1c1
Sequence:CCGGCAACAGCAACCACCAAGAGTTCTCGAGAACTCTTGGTGGTTGCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008435
KCNS1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008435.2-2067s21c1
Sequence:CCGGCACTAAGCCTTTGTCACTAAGCTCGAGCTTAGTGACAAAGGCTTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008435.2-1216s21c1
Sequence:CCGGGGGCAAGGTAGTGCAAGTGTTCTCGAGAACACTTGCACTACCTTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008435.2-2168s21c1
Sequence:CCGGTACTTCCTAGGGATGACTTACCTCGAGGTAAGTCATCCCTAGGAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008435.2-853s21c1
Sequence:CCGGCAAGCTCTTCAGCTGCGTATCCTCGAGGATACGCAGCTGAAGAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008435.1-1789s1c1
Sequence:CCGGGCCTGGGAATCAGCTAACACACTCGAGTGTGTTAGCTGATTCCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008435.1-782s1c1
Sequence:CCGGCCGTCGTCTCTGGCTCACCATCTCGAGATGGTGAGCCAGAGACGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008435.1-468s1c1
Sequence:CCGGGCGCACGAGTTCTACTTTGATCTCGAGATCAAAGTAGAACTCGTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008435.1-1082s1c1
Sequence:CCGGCCCGCTCAACCTCATTGACATCTCGAGATGTCAATGAGGTTGAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008435.1-1653s1c1
Sequence:CCGGGTATCGGATGTGTCTCTGGAACTCGAGTTCCAGAGACACATCCGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008435
KCNS1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008435.2-2067s21c1
Sequence:CCGGCACTAAGCCTTTGTCACTAAGCTCGAGCTTAGTGACAAAGGCTTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008435.2-1216s21c1
Sequence:CCGGGGGCAAGGTAGTGCAAGTGTTCTCGAGAACACTTGCACTACCTTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008435.2-2168s21c1
Sequence:CCGGTACTTCCTAGGGATGACTTACCTCGAGGTAAGTCATCCCTAGGAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008435.2-853s21c1
Sequence:CCGGCAAGCTCTTCAGCTGCGTATCCTCGAGGATACGCAGCTGAAGAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008435.1-1789s1c1
Sequence:CCGGGCCTGGGAATCAGCTAACACACTCGAGTGTGTTAGCTGATTCCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008435.1-782s1c1
Sequence:CCGGCCGTCGTCTCTGGCTCACCATCTCGAGATGGTGAGCCAGAGACGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008435.1-468s1c1
Sequence:CCGGGCGCACGAGTTCTACTTTGATCTCGAGATCAAAGTAGAACTCGTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008435.1-1082s1c1
Sequence:CCGGCCCGCTCAACCTCATTGACATCTCGAGATGTCAATGAGGTTGAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008435.1-1653s1c1
Sequence:CCGGGTATCGGATGTGTCTCTGGAACTCGAGTTCCAGAGACACATCCGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008435
KCNS1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008435.2-2067s21c1
Sequence:CCGGCACTAAGCCTTTGTCACTAAGCTCGAGCTTAGTGACAAAGGCTTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008435.2-1216s21c1
Sequence:CCGGGGGCAAGGTAGTGCAAGTGTTCTCGAGAACACTTGCACTACCTTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008435.2-2168s21c1
Sequence:CCGGTACTTCCTAGGGATGACTTACCTCGAGGTAAGTCATCCCTAGGAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008435.2-853s21c1
Sequence:CCGGCAAGCTCTTCAGCTGCGTATCCTCGAGGATACGCAGCTGAAGAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127204    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008435.1-1789s1c1
Sequence:CCGGGCCTGGGAATCAGCTAACACACTCGAGTGTGTTAGCTGATTCCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008435.1-782s1c1
Sequence:CCGGCCGTCGTCTCTGGCTCACCATCTCGAGATGGTGAGCCAGAGACGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008435.1-468s1c1
Sequence:CCGGGCGCACGAGTTCTACTTTGATCTCGAGATCAAAGTAGAACTCGTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008435.1-1082s1c1
Sequence:CCGGCCCGCTCAACCTCATTGACATCTCGAGATGTCAATGAGGTTGAGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008435.1-1653s1c1
Sequence:CCGGGTATCGGATGTGTCTCTGGAACTCGAGTTCCAGAGACACATCCGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)