EMAIL THIS PAGE TO A FRIEND

KCNS2

potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2

153 Gene Product Result for
Synonyms: KV9.2
UniProtKB ID: Q9ULS6, A8KAN1
Gene ID:
Mouse(16539) K+ voltage-gated channel, subfamily S, 2
Rat(66022) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2
chicken(430463) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2
cow(514860) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2
domestic cat(101094326) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2
dog(481979) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2
sheep(101106338) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2
Domestic Rabbit(100339632) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2
domestic guinea pig(100729974) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2
naked mole-rat(101714744) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Blocker

Product # Description Species Add to Cart
 
T154 Tityustoxin-Kα from Tityus serrulatus (Brazilian scorpion) venom lyophilized powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020697 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181317 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181317 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181317 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020697 Rosetta Predictions human pricing
NM_023966 Rosetta Predictions rat pricing
NM_181317 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017954 predicted 1678
2 SASI_Hs01_00017955 predicted 1246
3 SASI_Hs01_00017956 predicted 1565
4 SASI_Hs01_00017957 predicted 1743
5 SASI_Hs01_00017958 predicted 1747
6 SASI_Hs01_00017959 predicted 1125
7 SASI_Hs01_00017960 predicted 1696
8 SASI_Hs01_00017961 predicted 1690
9 SASI_Hs01_00017962 predicted 1304
10 SASI_Hs01_00017963 predicted 1853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023966 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066400 predicted 415
2 SASI_Rn01_00066401 predicted 265
3 SASI_Rn01_00066402 predicted 981
4 SASI_Rn01_00066403 predicted 538
5 SASI_Rn01_00066404 predicted 1395
6 SASI_Rn01_00066405 predicted 1106
7 SASI_Rn01_00066406 predicted 1430
8 SASI_Rn01_00066407 predicted 644
9 SASI_Rn01_00066409 predicted 989
10 SASI_Rn02_00263775 predicted 1406
11 SASI_Rn01_00066408 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181317 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082770 predicted 1282
2 SASI_Mm01_00082771 predicted 1401
3 SASI_Mm01_00082772 predicted 1856
4 SASI_Mm01_00082773 predicted 712
5 SASI_Mm01_00082774 predicted 1852
6 SASI_Mm01_00082775 predicted 1282
7 SASI_Mm01_00082776 predicted 836
8 SASI_Mm01_00082777 predicted 954
9 SASI_Mm01_00082778 predicted 1836
10 SASI_Mm01_00082779 predicted 1910
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020697
KCNS2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020697.2-1672s1c1
Sequence:CCGGCGGTCAATTTAAGGGACTATTCTCGAGAATAGTCCCTTAAATTGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020697.2-1112s1c1
Sequence:CCGGGTTCTTCAAGAATGCCCTAAACTCGAGTTTAGGGCATTCTTGAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020697.2-1250s1c1
Sequence:CCGGGCGGATCTTCCGCATCTTAAACTCGAGTTTAAGATGCGGAAGATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020697.2-585s1c1
Sequence:CCGGCCCTACGTGCTGCATTTCTATCTCGAGATAGAAATGCAGCACGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020697.2-1696s1c1
Sequence:CCGGCCCATAAAGTTAAATCCCTTACTCGAGTAAGGGATTTAACTTTATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020697.2-1854s21c1
Sequence:CCGGACCTTATGGTTATGGTGTAAGCTCGAGCTTACACCATAACCATAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020697
KCNS2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020697.2-1672s1c1
Sequence:CCGGCGGTCAATTTAAGGGACTATTCTCGAGAATAGTCCCTTAAATTGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020697.2-1112s1c1
Sequence:CCGGGTTCTTCAAGAATGCCCTAAACTCGAGTTTAGGGCATTCTTGAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020697.2-1250s1c1
Sequence:CCGGGCGGATCTTCCGCATCTTAAACTCGAGTTTAAGATGCGGAAGATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020697.2-585s1c1
Sequence:CCGGCCCTACGTGCTGCATTTCTATCTCGAGATAGAAATGCAGCACGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020697.2-1696s1c1
Sequence:CCGGCCCATAAAGTTAAATCCCTTACTCGAGTAAGGGATTTAACTTTATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020697.2-1854s21c1
Sequence:CCGGACCTTATGGTTATGGTGTAAGCTCGAGCTTACACCATAACCATAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020697
KCNS2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020697.2-1672s1c1
Sequence:CCGGCGGTCAATTTAAGGGACTATTCTCGAGAATAGTCCCTTAAATTGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020697.2-1112s1c1
Sequence:CCGGGTTCTTCAAGAATGCCCTAAACTCGAGTTTAGGGCATTCTTGAAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020697.2-1250s1c1
Sequence:CCGGGCGGATCTTCCGCATCTTAAACTCGAGTTTAAGATGCGGAAGATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020697.2-585s1c1
Sequence:CCGGCCCTACGTGCTGCATTTCTATCTCGAGATAGAAATGCAGCACGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020697.2-1696s1c1
Sequence:CCGGCCCATAAAGTTAAATCCCTTACTCGAGTAAGGGATTTAACTTTATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020697.2-1854s21c1
Sequence:CCGGACCTTATGGTTATGGTGTAAGCTCGAGCTTACACCATAACCATAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181317
KCNS2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181317.3-1914s1c1
Sequence:CCGGCCTAGTGAACTGAGTTTAGATCTCGAGATCTAAACTCAGTTCACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181317.3-2426s1c1
Sequence:CCGGCCTTGCTTTCATTTACCTTTACTCGAGTAAAGGTAAATGAAAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181317.3-1403s1c1
Sequence:CCGGCCTGAGGCTAATGAGGATCTTCTCGAGAAGATCCTCATTAGCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181317.3-1728s1c1
Sequence:CCGGCCCATCACTTTGATCTTCAATCTCGAGATTGAAGATCAAAGTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181317.3-1877s1c1
Sequence:CCGGCCTCATGGCAAGTCTGACAAACTCGAGTTTGTCAGACTTGCCATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181317
KCNS2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181317.3-1914s1c1
Sequence:CCGGCCTAGTGAACTGAGTTTAGATCTCGAGATCTAAACTCAGTTCACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181317.3-2426s1c1
Sequence:CCGGCCTTGCTTTCATTTACCTTTACTCGAGTAAAGGTAAATGAAAGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181317.3-1403s1c1
Sequence:CCGGCCTGAGGCTAATGAGGATCTTCTCGAGAAGATCCTCATTAGCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181317.3-1728s1c1
Sequence:CCGGCCCATCACTTTGATCTTCAATCTCGAGATTGAAGATCAAAGTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181317.3-1877s1c1
Sequence:CCGGCCTCATGGCAAGTCTGACAAACTCGAGTTTGTCAGACTTGCCATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181317
KCNS2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181317.3-1914s1c1
Sequence:CCGGCCTAGTGAACTGAGTTTAGATCTCGAGATCTAAACTCAGTTCACTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181317.3-2426s1c1
Sequence:CCGGCCTTGCTTTCATTTACCTTTACTCGAGTAAAGGTAAATGAAAGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181317.3-1403s1c1
Sequence:CCGGCCTGAGGCTAATGAGGATCTTCTCGAGAAGATCCTCATTAGCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181317.3-1728s1c1
Sequence:CCGGCCCATCACTTTGATCTTCAATCTCGAGATTGAAGATCAAAGTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181317.3-1877s1c1
Sequence:CCGGCCTCATGGCAAGTCTGACAAACTCGAGTTTGTCAGACTTGCCATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)