EMAIL THIS PAGE TO A FRIEND

KCNS3

potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3

81 Gene Product Result for
Synonyms: KV9.3
UniProtKB ID: Q9BQ31, D6W520, O43651, Q4ZFY1, Q96B56
Gene ID:
Human(3790) Summary: Voltage-gated potassium channels form the largest and most diversified class of ion channels and are present in both excitable and nonexcitable cells. Their main functions are associated with the regulation of the resting membrane potential and the control of the shape and frequency of action potentials. The alpha subunits are of 2 types: those that are functional by themselves and those that are electrically silent but capable of modulating the activity of specific functional alpha subunits. The protein encoded by this gene is not functional by itself but can form heteromultimers with member 1 and with member 2 (and possibly other members) of the Shab-related subfamily of potassium voltage-gated channel proteins. This gene belongs to the S subfamily of the potassium channel family. [provided by RefSeq, Jul 2008]
Mouse(238076) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
Rat(83588) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
domestic guinea pig(100722092) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
naked mole-rat(101718392) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
sheep(101101966) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
Domestic Rabbit(100009354) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
chicken(428653) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
dog(482982) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
cow(541460) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
domestic cat(101081796) potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002252 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002252 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002252 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173417 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173417 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173417 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002252 Rosetta Predictions human pricing
NM_031778 Rosetta Predictions rat pricing
NM_173417 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223624 predicted 531
2 SASI_Hs01_00223625 predicted 568
3 SASI_Hs01_00223626 predicted 1878
4 SASI_Hs01_00223627 predicted 1872
5 SASI_Hs01_00223629 predicted 1677
6 SASI_Hs02_00333499 predicted 1392
7 SASI_Hs01_00223630 predicted 1786
8 SASI_Hs01_00223631 predicted 1680
9 SASI_Hs01_00223632 predicted 565
10 SASI_Hs02_00333500 predicted 837
11 SASI_Hs01_00223623 predicted 871
12 SASI_Hs01_00223628 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035381 predicted 848
2 SASI_Rn01_00035382 predicted 841
3 SASI_Rn01_00035383 predicted 1877
4 SASI_Rn01_00035385 predicted 1689
5 SASI_Rn01_00035386 predicted 1928
6 SASI_Rn02_00265216 predicted 1697
7 SASI_Rn01_00035387 predicted 969
8 SASI_Rn01_00035388 predicted 514
9 SASI_Rn01_00035389 predicted 899
10 SASI_Rn01_00035390 predicted 543
11 SASI_Rn01_00035384 predicted 1847
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159307 predicted 905
2 SASI_Mm01_00159308 predicted 967
3 SASI_Mm01_00159309 predicted 919
4 SASI_Mm01_00159310 predicted 1954
5 SASI_Mm02_00345284 predicted 749
6 SASI_Mm01_00159311 predicted 1976
7 SASI_Mm01_00159312 predicted 1755
8 SASI_Mm01_00159313 predicted 1352
9 SASI_Mm01_00159314 predicted 625
10 SASI_Mm01_00159315 predicted 1830
11 SASI_Mm01_00159316 predicted 591
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002252
KCNS3 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002252.3-2022s21c1
Sequence:CCGGTTTCTCTGTGAGGTCAATTAACTCGAGTTAATTGACCTCACAGAGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002252.3-2165s21c1
Sequence:CCGGACTCACATTGAGCTAACTTTACTCGAGTAAAGTTAGCTCAATGTGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002252.3-1717s21c1
Sequence:CCGGAGCGGATGCACACCTTCATTACTCGAGTAATGAAGGTGTGCATCCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002252.3-567s1c1
Sequence:CCGGGCCGATAAGGAATACTACTTTCTCGAGAAAGTAGTATTCCTTATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002252.3-1831s1c1
Sequence:CCGGCCTTGGAGAATTGCACAGCAACTCGAGTTGCTGTGCAATTCTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002252.3-1140s1c1
Sequence:CCGGCCTCTGAACATCATTGACTTTCTCGAGAAAGTCAATGATGTTCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002252.3-1686s1c1
Sequence:CCGGCCTTACTTTAACATTAGGGATCTCGAGATCCCTAATGTTAAAGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002252.3-1788s1c1
Sequence:CCGGGCTTCAAGCATTGAAGACAATCTCGAGATTGTCTTCAATGCTTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002252.3-853s21c1
Sequence:CCGGAGTTTGACACACTGCGATTTGCTCGAGCAAATCGCAGTGTGTCAAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002252
KCNS3 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002252.3-2022s21c1
Sequence:CCGGTTTCTCTGTGAGGTCAATTAACTCGAGTTAATTGACCTCACAGAGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002252.3-2165s21c1
Sequence:CCGGACTCACATTGAGCTAACTTTACTCGAGTAAAGTTAGCTCAATGTGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002252.3-1717s21c1
Sequence:CCGGAGCGGATGCACACCTTCATTACTCGAGTAATGAAGGTGTGCATCCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002252.3-567s1c1
Sequence:CCGGGCCGATAAGGAATACTACTTTCTCGAGAAAGTAGTATTCCTTATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002252.3-1831s1c1
Sequence:CCGGCCTTGGAGAATTGCACAGCAACTCGAGTTGCTGTGCAATTCTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002252.3-1140s1c1
Sequence:CCGGCCTCTGAACATCATTGACTTTCTCGAGAAAGTCAATGATGTTCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002252.3-1686s1c1
Sequence:CCGGCCTTACTTTAACATTAGGGATCTCGAGATCCCTAATGTTAAAGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002252.3-1788s1c1
Sequence:CCGGGCTTCAAGCATTGAAGACAATCTCGAGATTGTCTTCAATGCTTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002252.3-853s21c1
Sequence:CCGGAGTTTGACACACTGCGATTTGCTCGAGCAAATCGCAGTGTGTCAAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002252
KCNS3 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435378    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002252.3-2022s21c1
Sequence:CCGGTTTCTCTGTGAGGTCAATTAACTCGAGTTAATTGACCTCACAGAGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002252.3-2165s21c1
Sequence:CCGGACTCACATTGAGCTAACTTTACTCGAGTAAAGTTAGCTCAATGTGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002252.3-1717s21c1
Sequence:CCGGAGCGGATGCACACCTTCATTACTCGAGTAATGAAGGTGTGCATCCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002252.3-567s1c1
Sequence:CCGGGCCGATAAGGAATACTACTTTCTCGAGAAAGTAGTATTCCTTATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002252.3-1831s1c1
Sequence:CCGGCCTTGGAGAATTGCACAGCAACTCGAGTTGCTGTGCAATTCTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002252.3-1140s1c1
Sequence:CCGGCCTCTGAACATCATTGACTTTCTCGAGAAAGTCAATGATGTTCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002252.3-1686s1c1
Sequence:CCGGCCTTACTTTAACATTAGGGATCTCGAGATCCCTAATGTTAAAGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002252.3-1788s1c1
Sequence:CCGGGCTTCAAGCATTGAAGACAATCTCGAGATTGTCTTCAATGCTTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002252.3-853s21c1
Sequence:CCGGAGTTTGACACACTGCGATTTGCTCGAGCAAATCGCAGTGTGTCAAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173417
KCNS3 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173417.1-938s1c1
Sequence:CCGGGCTCCGAAAGAAGATCTGGATCTCGAGATCCAGATCTTCTTTCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173417.1-1892s1c1
Sequence:CCGGCCTGGAGAACTGTACTGGAAACTCGAGTTTCCAGTACAGTTCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173417.1-1751s1c1
Sequence:CCGGCTTTAACATTAGGGACGTTTACTCGAGTAAACGTCCCTAATGTTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173417.1-2549s1c1
Sequence:CCGGCGAGTTTAATACTCAGTGAAACTCGAGTTTCACTGAGTATTAAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173417.1-627s1c1
Sequence:CCGGGCAGATAAAGAGTACTACTTTCTCGAGAAAGTAGTACTCTTTATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173417
KCNS3 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173417.1-938s1c1
Sequence:CCGGGCTCCGAAAGAAGATCTGGATCTCGAGATCCAGATCTTCTTTCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173417.1-1892s1c1
Sequence:CCGGCCTGGAGAACTGTACTGGAAACTCGAGTTTCCAGTACAGTTCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173417.1-1751s1c1
Sequence:CCGGCTTTAACATTAGGGACGTTTACTCGAGTAAACGTCCCTAATGTTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173417.1-2549s1c1
Sequence:CCGGCGAGTTTAATACTCAGTGAAACTCGAGTTTCACTGAGTATTAAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173417.1-627s1c1
Sequence:CCGGGCAGATAAAGAGTACTACTTTCTCGAGAAAGTAGTACTCTTTATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173417
KCNS3 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173417.1-938s1c1
Sequence:CCGGGCTCCGAAAGAAGATCTGGATCTCGAGATCCAGATCTTCTTTCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173417.1-1892s1c1
Sequence:CCGGCCTGGAGAACTGTACTGGAAACTCGAGTTTCCAGTACAGTTCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173417.1-1751s1c1
Sequence:CCGGCTTTAACATTAGGGACGTTTACTCGAGTAAACGTCCCTAATGTTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173417.1-2549s1c1
Sequence:CCGGCGAGTTTAATACTCAGTGAAACTCGAGTTTCACTGAGTATTAAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173417.1-627s1c1
Sequence:CCGGGCAGATAAAGAGTACTACTTTCTCGAGAAAGTAGTACTCTTTATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)