EMAIL THIS PAGE TO A FRIEND

KCNT1

potassium channel, subfamily T, member 1

47 Gene Product Result for
Synonyms: EIEE14 ENFL5 KCa4.1 SLACK bA100C15.2
UniProtKB ID: Q5JUK3, B7ZVY4, B9EGP2, Q9P2C5
Gene ID:
Human(57582) Summary: Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a sodium-activated potassium channel subunit which is thought to function in ion conductance and developmental signaling pathways. Mutations in this gene cause the early-onset epileptic disorders, malignant migrating partial seizures of infancy and autosomal dominant nocturnal frontal lobe epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Mouse(227632) potassium channel, subfamily T, member 1
Rat(60444) potassium channel, subfamily T, member 1
Zebrafish(100004419) potassium channel, subfamily T, member 1
chicken(395248) potassium channel, subfamily T, member 1
cow(529468) potassium channel, subfamily T, member 1
domestic cat(101091413) potassium channel, subfamily T, member 1
dog(491258) potassium channel, subfamily T, member 1
sheep(101118349) potassium channel, subfamily T, member 1
domestic guinea pig(100734549) potassium channel, subfamily T, member 1
naked mole-rat(101718795) potassium channel, subfamily T, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_029962 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_029962 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_029962 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175462 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175462 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175462 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149391 MISSION® esiRNA esiRNA human KCNT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020822 Rosetta Predictions human pricing
NM_021853 Rosetta Predictions rat pricing
NM_175462 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224935 predicted 3571
2 SASI_Hs01_00224937 predicted 3590
3 SASI_Hs01_00224938 predicted 3602
4 SASI_Hs02_00354038 predicted 559
5 SASI_Hs01_00224939 predicted 2739
6 SASI_Hs01_00224940 predicted 548
7 SASI_Hs01_00224941 predicted 2830
8 SASI_Hs01_00224942 predicted 1764
9 SASI_Hs01_00224943 predicted 1365
10 SASI_Hs01_00224944 predicted 1547
11 SASI_Hs01_00224936 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021853 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069029 predicted 285
2 SASI_Rn01_00069030 predicted 537
3 SASI_Rn01_00069031 predicted 381
4 SASI_Rn02_00262880 predicted 2549
5 SASI_Rn01_00069032 predicted 2323
6 SASI_Rn01_00069033 predicted 550
7 SASI_Rn01_00069034 predicted 1046
8 SASI_Rn01_00069035 predicted 3478
9 SASI_Rn01_00069036 predicted 1625
10 SASI_Rn01_00069038 predicted 3105
11 SASI_Rn01_00069037 predicted 1839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164321 predicted 3455
2 SASI_Mm01_00164322 predicted 556
3 SASI_Mm01_00164323 predicted 2840
4 SASI_Mm01_00164324 predicted 2460
5 SASI_Mm01_00164325 predicted 3464
6 SASI_Mm01_00164326 predicted 404
7 SASI_Mm01_00164327 predicted 571
8 SASI_Mm01_00164328 predicted 3500
9 SASI_Mm01_00164329 predicted 1645
10 SASI_Mm01_00164330 predicted 1857
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_029962
KCNT1 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily T, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029962.4-662s1c1
Sequence:CCGGCCTCAGCTACAAAGGCAACATCTCGAGATGTTGCCTTTGTAGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029962.4-2471s1c1
Sequence:CCGGCGGGTTCAAGAACAAGCTGATCTCGAGATCAGCTTGTTCTTGAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029962.4-3594s1c1
Sequence:CCGGGCAAATTTAACAGCCAGTGATCTCGAGATCACTGGCTGTTAAATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029962.4-422s1c1
Sequence:CCGGGCTGTTCAACTTCTCCCTGAACTCGAGTTCAGGGAGAAGTTGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029962.4-1280s1c1
Sequence:CCGGCCAGGACTATTACGTGGTCATCTCGAGATGACCACGTAATAGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_029962
KCNT1 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily T, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029962.4-662s1c1
Sequence:CCGGCCTCAGCTACAAAGGCAACATCTCGAGATGTTGCCTTTGTAGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029962.4-2471s1c1
Sequence:CCGGCGGGTTCAAGAACAAGCTGATCTCGAGATCAGCTTGTTCTTGAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029962.4-3594s1c1
Sequence:CCGGGCAAATTTAACAGCCAGTGATCTCGAGATCACTGGCTGTTAAATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029962.4-422s1c1
Sequence:CCGGGCTGTTCAACTTCTCCCTGAACTCGAGTTCAGGGAGAAGTTGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029962.4-1280s1c1
Sequence:CCGGCCAGGACTATTACGTGGTCATCTCGAGATGACCACGTAATAGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_029962
KCNT1 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily T, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029962.4-662s1c1
Sequence:CCGGCCTCAGCTACAAAGGCAACATCTCGAGATGTTGCCTTTGTAGCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029962.4-2471s1c1
Sequence:CCGGCGGGTTCAAGAACAAGCTGATCTCGAGATCAGCTTGTTCTTGAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029962.4-3594s1c1
Sequence:CCGGGCAAATTTAACAGCCAGTGATCTCGAGATCACTGGCTGTTAAATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029962.4-422s1c1
Sequence:CCGGGCTGTTCAACTTCTCCCTGAACTCGAGTTCAGGGAGAAGTTGAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_029962.4-1280s1c1
Sequence:CCGGCCAGGACTATTACGTGGTCATCTCGAGATGACCACGTAATAGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175462
KCNT1 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily T, member 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175462.3-3595s21c1
Sequence:CCGGGACTGGAACCCAACGACATTGCTCGAGCAATGTCGTTGGGTTCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175462.3-4630s1c1
Sequence:CCGGGCTGACTTCATTCTTGTTTATCTCGAGATAAACAAGAATGAAGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175462.3-3416s1c1
Sequence:CCGGGCTGGTCAAGAACCGAATGAACTCGAGTTCATTCGGTTCTTGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175462.3-990s1c1
Sequence:CCGGCCACTGCAATTTGAAGAGCTTCTCGAGAAGCTCTTCAAATTGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175462.3-406s1c1
Sequence:CCGGGCACGAAGTATAACTACACTTCTCGAGAAGTGTAGTTATACTTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175462.3-1949s1c1
Sequence:CCGGGCATAGCATCATCGCCTCTATCTCGAGATAGAGGCGATGATGCTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175462.3-1636s21c1
Sequence:CCGGGCAACGAGGTGTACCACATTCCTCGAGGAATGTGGTACACCTCGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175462
KCNT1 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily T, member 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175462.3-3595s21c1
Sequence:CCGGGACTGGAACCCAACGACATTGCTCGAGCAATGTCGTTGGGTTCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175462.3-4630s1c1
Sequence:CCGGGCTGACTTCATTCTTGTTTATCTCGAGATAAACAAGAATGAAGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175462.3-3416s1c1
Sequence:CCGGGCTGGTCAAGAACCGAATGAACTCGAGTTCATTCGGTTCTTGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175462.3-990s1c1
Sequence:CCGGCCACTGCAATTTGAAGAGCTTCTCGAGAAGCTCTTCAAATTGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175462.3-406s1c1
Sequence:CCGGGCACGAAGTATAACTACACTTCTCGAGAAGTGTAGTTATACTTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175462.3-1949s1c1
Sequence:CCGGGCATAGCATCATCGCCTCTATCTCGAGATAGAGGCGATGATGCTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175462.3-1636s21c1
Sequence:CCGGGCAACGAGGTGTACCACATTCCTCGAGGAATGTGGTACACCTCGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175462
KCNT1 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily T, member 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175462.3-3595s21c1
Sequence:CCGGGACTGGAACCCAACGACATTGCTCGAGCAATGTCGTTGGGTTCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175462.3-4630s1c1
Sequence:CCGGGCTGACTTCATTCTTGTTTATCTCGAGATAAACAAGAATGAAGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175462.3-3416s1c1
Sequence:CCGGGCTGGTCAAGAACCGAATGAACTCGAGTTCATTCGGTTCTTGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175462.3-990s1c1
Sequence:CCGGCCACTGCAATTTGAAGAGCTTCTCGAGAAGCTCTTCAAATTGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175462.3-406s1c1
Sequence:CCGGGCACGAAGTATAACTACACTTCTCGAGAAGTGTAGTTATACTTCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175462.3-1949s1c1
Sequence:CCGGGCATAGCATCATCGCCTCTATCTCGAGATAGAGGCGATGATGCTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175462.3-1636s21c1
Sequence:CCGGGCAACGAGGTGTACCACATTCCTCGAGGAATGTGGTACACCTCGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)