EMAIL THIS PAGE TO A FRIEND

KCNT2

potassium channel, subfamily T, member 2

114 Gene Product Result for
Synonyms: KCa4.2 SLICK SLO2.1
UniProtKB ID: Q6UVM3, Q3SY59, Q5VTN1, Q6ZMT3
Gene ID:
Mouse(240776) potassium channel, subfamily T, member 2
Rat(304827) potassium channel, subfamily T, member 2
domestic guinea pig(100734180) potassium channel, subfamily T, member 2
naked mole-rat(101709091) potassium channel, subfamily T, member 2
sheep(101115980) potassium channel, subfamily T, member 2
Domestic Rabbit(100348012) potassium channel, subfamily T, member 2
Zebrafish(568327) potassium channel, subfamily T, member 2
cow(781505) potassium channel, subfamily T, member 2
Horse(100051286) potassium channel, subfamily T, member 2
domestic cat(101090412) potassium channel, subfamily T, member 2
dog(607500) potassium channel, subfamily T, member 2
chicken(429058) potassium channel, subfamily T, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198503 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081027 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081027 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081027 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198503 Rosetta Predictions human pricing
NM_198762 Rosetta Predictions rat pricing
NM_001081027 Rosetta Predictions mouse pricing
XM_001003068 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372071 predicted 3328
2 SASI_Hs01_00191107 predicted 2070
3 SASI_Hs02_00372072 predicted 1627
4 SASI_Hs01_00191109 predicted 931
5 SASI_Hs01_00191110 predicted 1981
6 SASI_Hs01_00191111 predicted 2310
7 SASI_Hs01_00191112 predicted 465
8 SASI_Hs01_00191113 predicted 2388
9 SASI_Hs01_00191114 predicted 706
10 SASI_Hs02_00372073 predicted 804
11 SASI_Hs01_00191106 predicted 2440
12 SASI_Hs01_00191108 predicted 1364
13 SASI_Hs01_00191115 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100548 predicted 2445
2 SASI_Rn01_00100549 predicted 1394
3 SASI_Rn02_00270002 predicted 2905
4 SASI_Rn01_00100550 predicted 213
5 SASI_Rn01_00100551 predicted 3177
6 SASI_Rn01_00100552 predicted 2398
7 SASI_Rn01_00100554 predicted 2710
8 SASI_Rn02_00270003 predicted 2953
9 SASI_Rn01_00100555 predicted 2067
10 SASI_Rn01_00100556 predicted 1802
11 SASI_Rn01_00100553 predicted 785
12 SASI_Rn01_00100557 predicted 2874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294478 predicted 262
2 SASI_Mm02_00294479 predicted 619
3 SASI_Mm02_00294480 predicted 1349
4 SASI_Mm02_00294481 predicted 2904
5 SASI_Mm02_00294482 predicted 2521
6 SASI_Mm02_00294483 predicted 2670
7 SASI_Mm02_00294484 predicted 1033
8 SASI_Mm02_00294485 predicted 461
9 SASI_Mm02_00294486 predicted 2852
10 SASI_Mm02_00294487 predicted 2818
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251645 predicted 268
2 SASI_Mm01_00251646 predicted 628
3 SASI_Mm01_00251647 predicted 1362
4 SASI_Mm01_00251648 predicted 2358
5 SASI_Mm01_00251649 predicted 2926
6 SASI_Mm01_00251650 predicted 2552
7 SASI_Mm01_00251651 predicted 2700
8 SASI_Mm01_00251652 predicted 1035
9 SASI_Mm01_00251653 predicted 470
10 SASI_Mm01_00251654 predicted 2874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198503
KCNT2 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily T, member 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198503.2-383s21c1
Sequence:CCGGAGGTTTCAGTGGCATTGATAACTCGAGTTATCAATGCCACTGAAACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198503.2-2684s1c1
Sequence:CCGGCCTTTATGTTTCGACTGCCTTCTCGAGAAGGCAGTCGAAACATAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198503.2-475s1c1
Sequence:CCGGCCCTTCATCTTGGAAATAATTCTCGAGAATTATTTCCAAGATGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198503.2-1151s1c1
Sequence:CCGGCCCTTAAAGATCAAGACCTATCTCGAGATAGGTCTTGATCTTTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198503.2-1041s1c1
Sequence:CCGGCCAGGATTATTATGTGGTGATCTCGAGATCACCACATAATAATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198503.2-2062s1c1
Sequence:CCGGGCTAAAGGTTACCCACCTTATCTCGAGATAAGGTGGGTAACCTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198503.2-99s21c1
Sequence:CCGGCAGGTACAGGTTTCGAGATTTCTCGAGAAATCTCGAAACCTGTACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198503
KCNT2 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily T, member 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198503.2-383s21c1
Sequence:CCGGAGGTTTCAGTGGCATTGATAACTCGAGTTATCAATGCCACTGAAACCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000056255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198503.2-2684s1c1
Sequence:CCGGCCTTTATGTTTCGACTGCCTTCTCGAGAAGGCAGTCGAAACATAAAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000056257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198503.2-475s1c1
Sequence:CCGGCCCTTCATCTTGGAAATAATTCTCGAGAATTATTTCCAAGATGAAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000056253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198503.2-1151s1c1
Sequence:CCGGCCCTTAAAGATCAAGACCTATCTCGAGATAGGTCTTGATCTTTAAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000056254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198503.2-1041s1c1
Sequence:CCGGCCAGGATTATTATGTGGTGATCTCGAGATCACCACATAATAATCCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000056256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198503.2-2062s1c1
Sequence:CCGGGCTAAAGGTTACCCACCTTATCTCGAGATAAGGTGGGTAACCTTTAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000428952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198503.2-99s21c1
Sequence:CCGGCAGGTACAGGTTTCGAGATTTCTCGAGAAATCTCGAAACCTGTACCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198503
KCNT2 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily T, member 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198503.2-383s21c1
Sequence:CCGGAGGTTTCAGTGGCATTGATAACTCGAGTTATCAATGCCACTGAAACCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198503.2-2684s1c1
Sequence:CCGGCCTTTATGTTTCGACTGCCTTCTCGAGAAGGCAGTCGAAACATAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198503.2-475s1c1
Sequence:CCGGCCCTTCATCTTGGAAATAATTCTCGAGAATTATTTCCAAGATGAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198503.2-1151s1c1
Sequence:CCGGCCCTTAAAGATCAAGACCTATCTCGAGATAGGTCTTGATCTTTAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198503.2-1041s1c1
Sequence:CCGGCCAGGATTATTATGTGGTGATCTCGAGATCACCACATAATAATCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198503.2-2062s1c1
Sequence:CCGGGCTAAAGGTTACCCACCTTATCTCGAGATAAGGTGGGTAACCTTTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198503.2-99s21c1
Sequence:CCGGCAGGTACAGGTTTCGAGATTTCTCGAGAAATCTCGAAACCTGTACCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081027
KCNT2 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily T, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081027.2-2265s21c1
Sequence:CCGGATTGGATAACCCGCCAGATATCTCGAGATATCTGGCGGGTTATCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081027.2-3198s21c1
Sequence:CCGGGACGGTGGGCTACGATGAAATCTCGAGATTTCATCGTAGCCCACCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081027.2-2208s21c1
Sequence:CCGGTGTACCTCTCAGGGCATATTACTCGAGTAATATGCCCTGAGAGGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081027.2-971s21c1
Sequence:CCGGATCCAAGACTACAGGATTATTCTCGAGAATAATCCTGTAGTCTTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081027.2-3694s21c1
Sequence:CCGGCACAAGTATCGGCAGTCAATTCTCGAGAATTGACTGCCGATACTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081027
KCNT2 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily T, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081027.2-2265s21c1
Sequence:CCGGATTGGATAACCCGCCAGATATCTCGAGATATCTGGCGGGTTATCCAATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000253222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081027.2-3198s21c1
Sequence:CCGGGACGGTGGGCTACGATGAAATCTCGAGATTTCATCGTAGCCCACCGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000265354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081027.2-2208s21c1
Sequence:CCGGTGTACCTCTCAGGGCATATTACTCGAGTAATATGCCCTGAGAGGTACATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000253223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081027.2-971s21c1
Sequence:CCGGATCCAAGACTACAGGATTATTCTCGAGAATAATCCTGTAGTCTTGGATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000265352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081027.2-3694s21c1
Sequence:CCGGCACAAGTATCGGCAGTCAATTCTCGAGAATTGACTGCCGATACTTGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081027
KCNT2 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily T, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081027.2-2265s21c1
Sequence:CCGGATTGGATAACCCGCCAGATATCTCGAGATATCTGGCGGGTTATCCAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081027.2-3198s21c1
Sequence:CCGGGACGGTGGGCTACGATGAAATCTCGAGATTTCATCGTAGCCCACCGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081027.2-2208s21c1
Sequence:CCGGTGTACCTCTCAGGGCATATTACTCGAGTAATATGCCCTGAGAGGTACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081027.2-971s21c1
Sequence:CCGGATCCAAGACTACAGGATTATTCTCGAGAATAATCCTGTAGTCTTGGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081027.2-3694s21c1
Sequence:CCGGCACAAGTATCGGCAGTCAATTCTCGAGAATTGACTGCCGATACTTGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)