EMAIL THIS PAGE TO A FRIEND

KCNU1

potassium channel, subfamily U, member 1

29 Gene Product Result for
Synonyms: KCNMC1 KCa5 KCa5.1 Kcnma3 Slo3
UniProtKB ID: A8MYU2
Gene ID:
Mouse(16532) potassium channel, subfamily U, member 1
Rat(680912) potassium channel, subfamily U, member 1
dog(482856) potassium channel subfamily U member 1-like
Horse(100060065) potassium channel, subfamily U, member 1
cow(524144) potassium channel, subfamily U, member 1
sheep(101110209) potassium channel, subfamily U, member 1
domestic guinea pig(100730592) potassium channel, subfamily U, member 1
naked mole-rat(101722235) potassium channel, subfamily U, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5200039 Monoclonal Anti-KCNU1 antibody produced in mouse clone S2-16, 1 mg/mL, purified immunoglobulin mouse
immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001031836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031836 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008432 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008432 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008432 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU073801 MISSION® esiRNA esiRNA targeting mouse Kcnu1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031836 Rosetta Predictions human pricing
NM_008432 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307837 predicted 1313
2 SASI_Hs02_00307838 predicted 2220
3 SASI_Hs02_00307839 predicted 1826
4 SASI_Hs02_00307840 predicted 2011
5 SASI_Hs02_00307841 predicted 1680
6 SASI_Hs02_00307842 predicted 2275
7 SASI_Hs02_00307843 predicted 1132
8 SASI_Hs02_00307844 predicted 3432
9 SASI_Hs02_00307845 predicted 3484
10 SASI_Hs02_00307846 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008432 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313905 predicted 674
2 SASI_Mm01_00170874 predicted 413
3 SASI_Mm01_00170875 predicted 1548
4 SASI_Mm01_00170876 predicted 244
5 SASI_Mm01_00170877 predicted 2917
6 SASI_Mm02_00313906 predicted 453
7 SASI_Mm01_00170879 predicted 2788
8 SASI_Mm01_00170880 predicted 260
9 SASI_Mm01_00170881 predicted 2959
10 SASI_Mm01_00170882 predicted 1859
11 SASI_Mm01_00170878 predicted 420
12 SASI_Mm01_00170883 predicted 3007
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031836
KCNU1 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily U, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031836.2-3531s21c1
Sequence:CCGGACTATAGACCTGCCCATATTCCTCGAGGAATATGGGCAGGTCTATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031836.2-3078s21c1
Sequence:CCGGTGTTGGCTTATACCGAATAATCTCGAGATTATTCGGTATAAGCCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031836.2-3585s21c1
Sequence:CCGGTCTCCTGAGATGCTAACTTTGCTCGAGCAAAGTTAGCATCTCAGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031836.2-2013s21c1
Sequence:CCGGGGGAATCTCCTCTCGTATATCCTCGAGGATATACGAGAGGAGATTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031836.2-1208s21c1
Sequence:CCGGTGGAACTTGAAACCATATTTACTCGAGTAAATATGGTTTCAAGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031836
KCNU1 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily U, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031836.2-3531s21c1
Sequence:CCGGACTATAGACCTGCCCATATTCCTCGAGGAATATGGGCAGGTCTATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031836.2-3078s21c1
Sequence:CCGGTGTTGGCTTATACCGAATAATCTCGAGATTATTCGGTATAAGCCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031836.2-3585s21c1
Sequence:CCGGTCTCCTGAGATGCTAACTTTGCTCGAGCAAAGTTAGCATCTCAGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031836.2-2013s21c1
Sequence:CCGGGGGAATCTCCTCTCGTATATCCTCGAGGATATACGAGAGGAGATTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031836.2-1208s21c1
Sequence:CCGGTGGAACTTGAAACCATATTTACTCGAGTAAATATGGTTTCAAGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031836
KCNU1 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily U, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031836.2-3531s21c1
Sequence:CCGGACTATAGACCTGCCCATATTCCTCGAGGAATATGGGCAGGTCTATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031836.2-3078s21c1
Sequence:CCGGTGTTGGCTTATACCGAATAATCTCGAGATTATTCGGTATAAGCCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031836.2-3585s21c1
Sequence:CCGGTCTCCTGAGATGCTAACTTTGCTCGAGCAAAGTTAGCATCTCAGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031836.2-2013s21c1
Sequence:CCGGGGGAATCTCCTCTCGTATATCCTCGAGGATATACGAGAGGAGATTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031836.2-1208s21c1
Sequence:CCGGTGGAACTTGAAACCATATTTACTCGAGTAAATATGGTTTCAAGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008432
KCNU1 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily U, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008432.1-1950s1c1
Sequence:CCGGCGCTTCTATGTCAACAGAAATCTCGAGATTTCTGTTGACATAGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008432.1-2617s1c1
Sequence:CCGGCCCTCCAACATCCACTTTATTCTCGAGAATAAAGTGGATGTTGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008432.1-1426s1c1
Sequence:CCGGGCAGAGCTAAAGCTCGGATTTCTCGAGAAATCCGAGCTTTAGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008432.1-438s1c1
Sequence:CCGGCGCTTTCTTTAGCTTCTATTTCTCGAGAAATAGAAGCTAAAGAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008432.1-1232s1c1
Sequence:CCGGGCCTGATTCTAGCCAACCATTCTCGAGAATGGTTGGCTAGAATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008432
KCNU1 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily U, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008432.1-1950s1c1
Sequence:CCGGCGCTTCTATGTCAACAGAAATCTCGAGATTTCTGTTGACATAGAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008432.1-2617s1c1
Sequence:CCGGCCCTCCAACATCCACTTTATTCTCGAGAATAAAGTGGATGTTGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008432.1-1426s1c1
Sequence:CCGGGCAGAGCTAAAGCTCGGATTTCTCGAGAAATCCGAGCTTTAGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008432.1-438s1c1
Sequence:CCGGCGCTTTCTTTAGCTTCTATTTCTCGAGAAATAGAAGCTAAAGAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008432.1-1232s1c1
Sequence:CCGGGCCTGATTCTAGCCAACCATTCTCGAGAATGGTTGGCTAGAATCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008432
KCNU1 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily U, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008432.1-1950s1c1
Sequence:CCGGCGCTTCTATGTCAACAGAAATCTCGAGATTTCTGTTGACATAGAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008432.1-2617s1c1
Sequence:CCGGCCCTCCAACATCCACTTTATTCTCGAGAATAAAGTGGATGTTGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008432.1-1426s1c1
Sequence:CCGGGCAGAGCTAAAGCTCGGATTTCTCGAGAAATCCGAGCTTTAGCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008432.1-438s1c1
Sequence:CCGGCGCTTTCTTTAGCTTCTATTTCTCGAGAAATAGAAGCTAAAGAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008432.1-1232s1c1
Sequence:CCGGGCCTGATTCTAGCCAACCATTCTCGAGAATGGTTGGCTAGAATCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)