EMAIL THIS PAGE TO A FRIEND

KCNV1

potassium channel, subfamily V, member 1

65 Gene Product Result for
Synonyms: HNKA KCNB3 KV2.3 KV8.1
UniProtKB ID: Q6PIU1, Q9UHJ4
Gene ID:
Human(27012) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium voltage-gated channel subfamily V. This protein is essentially present in the brain, and its role might be to inhibit the function of a particular class of outward rectifier potassium channel types. [provided by RefSeq, Jul 2008]
Mouse(67498) potassium channel, subfamily V, member 1
Rat(60326) potassium channel, subfamily V, member 1
domestic guinea pig(100726358) potassium channel, subfamily V, member 1
sheep(101117169) potassium channel, subfamily V, member 1
Domestic Rabbit(100344555) potassium channel, subfamily V, member 1
chicken(420278) potassium channel, subfamily V, member 1
domestic cat(101090486) potassium channel, subfamily V, member 1
cow(505732) potassium channel, subfamily V, member 1
dog(482009) potassium channel, subfamily V, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303052 ANTI-KCNV1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
flow cytometry, immunohistochemistry, western blot pricing
SAB2101232 Anti-KCNV1 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026200 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026200 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026200 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014379 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058341 MISSION® esiRNA esiRNA human KCNV1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014379 Rosetta Predictions human pricing
NM_021697 Rosetta Predictions rat pricing
NM_026200 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185582 predicted 1601
2 SASI_Hs01_00185584 predicted 1024
3 SASI_Hs01_00185585 predicted 852
4 SASI_Hs01_00185586 predicted 1793
5 SASI_Hs02_00345537 predicted 666
6 SASI_Hs01_00185587 predicted 1310
7 SASI_Hs01_00185588 predicted 1900
8 SASI_Hs01_00185589 predicted 1070
9 SASI_Hs01_00185590 predicted 1740
10 SASI_Hs01_00185591 predicted 1910
11 SASI_Hs01_00185583 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021697 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044648 predicted 1582
2 SASI_Rn01_00044649 predicted 1547
3 SASI_Rn01_00044650 predicted 347
4 SASI_Rn01_00044651 predicted 1288
5 SASI_Rn01_00044652 predicted 1593
6 SASI_Rn01_00044653 predicted 1074
7 SASI_Rn02_00262738 predicted 1270
8 SASI_Rn02_00262739 predicted 1530
9 SASI_Rn01_00044656 predicted 1622
10 SASI_Rn01_00044657 predicted 1320
11 SASI_Rn01_00044654 predicted 496
12 SASI_Rn01_00044655 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026200 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049633 predicted 519
2 SASI_Mm01_00049634 predicted 1160
3 SASI_Mm02_00329866 predicted 1037
4 SASI_Mm01_00049635 predicted 1461
5 SASI_Mm01_00049637 predicted 1221
6 SASI_Mm01_00049639 predicted 1046
7 SASI_Mm01_00049640 predicted 1572
8 SASI_Mm01_00049641 predicted 1311
9 SASI_Mm01_00049642 predicted 1487
10 SASI_Mm02_00329867 predicted 1597
11 SASI_Mm01_00049636 predicted 1727
12 SASI_Mm01_00049638 predicted 878
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026200
KCNV1 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily V, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026200.1-527s1c1
Sequence:CCGGCGTTATGTCCTGCACTACTATCTCGAGATAGTAGTGCAGGACATAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026200.1-1616s1c1
Sequence:CCGGCGGAGCATAATGGAGATGCTTCTCGAGAAGCATCTCCATTATGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026200.1-676s1c1
Sequence:CCGGGCTGAGTGAAACTCTTGACTTCTCGAGAAGTCAAGAGTTTCACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026200.1-2700s1c1
Sequence:CCGGGCCTAGACATTGTGAAATATACTCGAGTATATTTCACAATGTCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026200.1-1457s1c1
Sequence:CCGGGCCTTGCCTATTGCCATTATTCTCGAGAATAATGGCAATAGGCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026200
KCNV1 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily V, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026200.1-527s1c1
Sequence:CCGGCGTTATGTCCTGCACTACTATCTCGAGATAGTAGTGCAGGACATAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026200.1-1616s1c1
Sequence:CCGGCGGAGCATAATGGAGATGCTTCTCGAGAAGCATCTCCATTATGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026200.1-676s1c1
Sequence:CCGGGCTGAGTGAAACTCTTGACTTCTCGAGAAGTCAAGAGTTTCACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026200.1-2700s1c1
Sequence:CCGGGCCTAGACATTGTGAAATATACTCGAGTATATTTCACAATGTCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026200.1-1457s1c1
Sequence:CCGGGCCTTGCCTATTGCCATTATTCTCGAGAATAATGGCAATAGGCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026200
KCNV1 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily V, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026200.1-527s1c1
Sequence:CCGGCGTTATGTCCTGCACTACTATCTCGAGATAGTAGTGCAGGACATAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026200.1-1616s1c1
Sequence:CCGGCGGAGCATAATGGAGATGCTTCTCGAGAAGCATCTCCATTATGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026200.1-676s1c1
Sequence:CCGGGCTGAGTGAAACTCTTGACTTCTCGAGAAGTCAAGAGTTTCACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026200.1-2700s1c1
Sequence:CCGGGCCTAGACATTGTGAAATATACTCGAGTATATTTCACAATGTCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026200.1-1457s1c1
Sequence:CCGGGCCTTGCCTATTGCCATTATTCTCGAGAATAATGGCAATAGGCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014379
KCNV1 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily V, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014379.2-927s1c1
Sequence:CCGGGCTCTGGAATATCCTGGAGAACTCGAGTTCTCCAGGATATTCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014379.2-1392s1c1
Sequence:CCGGCCTATTTCTATCCGTGGGAATCTCGAGATTCCCACGGATAGAAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014379.2-2223s1c1
Sequence:CCGGGCCCAGAGAAAGATAAGTAAACTCGAGTTTACTTATCTTTCTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014379.2-822s1c1
Sequence:CCGGGCTGAGTGAAACTTTAGACTTCTCGAGAAGTCTAAAGTTTCACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014379.2-1572s1c1
Sequence:CCGGCATGTGTATATTATCGGGAATCTCGAGATTCCCGATAATATACACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014379
KCNV1 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily V, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014379.2-927s1c1
Sequence:CCGGGCTCTGGAATATCCTGGAGAACTCGAGTTCTCCAGGATATTCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014379.2-1392s1c1
Sequence:CCGGCCTATTTCTATCCGTGGGAATCTCGAGATTCCCACGGATAGAAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014379.2-2223s1c1
Sequence:CCGGGCCCAGAGAAAGATAAGTAAACTCGAGTTTACTTATCTTTCTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014379.2-822s1c1
Sequence:CCGGGCTGAGTGAAACTTTAGACTTCTCGAGAAGTCTAAAGTTTCACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014379.2-1572s1c1
Sequence:CCGGCATGTGTATATTATCGGGAATCTCGAGATTCCCGATAATATACACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014379
KCNV1 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily V, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014379.2-927s1c1
Sequence:CCGGGCTCTGGAATATCCTGGAGAACTCGAGTTCTCCAGGATATTCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014379.2-1392s1c1
Sequence:CCGGCCTATTTCTATCCGTGGGAATCTCGAGATTCCCACGGATAGAAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014379.2-2223s1c1
Sequence:CCGGGCCCAGAGAAAGATAAGTAAACTCGAGTTTACTTATCTTTCTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014379.2-822s1c1
Sequence:CCGGGCTGAGTGAAACTTTAGACTTCTCGAGAAGTCTAAAGTTTCACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014379.2-1572s1c1
Sequence:CCGGCATGTGTATATTATCGGGAATCTCGAGATTCCCGATAATATACACATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)