EMAIL THIS PAGE TO A FRIEND

KCNV2

potassium channel, subfamily V, member 2

52 Gene Product Result for
Synonyms: KV11.1 Kv8.2 RCD3B
UniProtKB ID: Q8TDN2, Q5T6X0
Gene ID:
Human(169522) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium voltage-gated channel subfamily V. This member is identified as a 'silent subunit', and it does not form homomultimers, but forms heteromultimers with several other subfamily members. Through obligatory heteromerization, it exerts a function-altering effect on other potassium channel subunits. This protein is strongly expressed in pancreas and has a weaker expression in several other tissues. [provided by RefSeq, Jul 2008]
Mouse(240595) potassium channel, subfamily V, member 2
Rat(294065) potassium channel, subfamily V, member 2
chicken(431642) potassium channel, subfamily V, member 2
dog(609438) potassium channel, subfamily V, member 2
cow(784234) potassium channel, subfamily V, member 2
domestic cat(101100847) potassium channel, subfamily V, member 2
sheep(101117399) potassium channel, subfamily V, member 2
domestic guinea pig(100722360) potassium channel, subfamily V, member 2
naked mole-rat(101717244) potassium channel, subfamily V, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133497 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133497 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133497 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183179 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183179 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183179 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133497 Rosetta Predictions human pricing
NM_001106370 Rosetta Predictions rat pricing
NM_183179 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014745 predicted 844
2 SASI_Hs01_00014746 predicted 1479
3 SASI_Hs01_00014747 predicted 1145
4 SASI_Hs01_00014748 predicted 1647
5 SASI_Hs01_00014749 predicted 343
6 SASI_Hs01_00014750 predicted 358
7 SASI_Hs01_00014752 predicted 627
8 SASI_Hs01_00014753 predicted 644
9 SASI_Hs01_00014754 predicted 250
10 SASI_Hs02_00363225 predicted 678
11 SASI_Hs01_00014751 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106370 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218298 predicted 2286
2 SASI_Rn02_00218299 predicted 560
3 SASI_Rn02_00218300 predicted 2097
4 SASI_Rn02_00218301 predicted 926
5 SASI_Rn02_00218302 predicted 2253
6 SASI_Rn02_00218303 predicted 1590
7 SASI_Rn02_00218304 predicted 2098
8 SASI_Rn02_00218305 predicted 2249
9 SASI_Rn02_00218306 predicted 2076
10 SASI_Rn02_00218307 predicted 1515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134220 predicted 293
2 SASI_Mm01_00134221 predicted 1913
3 SASI_Mm01_00134222 predicted 422
4 SASI_Mm02_00350287 predicted 1723
5 SASI_Mm01_00134223 predicted 308
6 SASI_Mm02_00350288 predicted 1459
7 SASI_Mm01_00134225 predicted 432
8 SASI_Mm01_00134226 predicted 1671
9 SASI_Mm01_00134227 predicted 1834
10 SASI_Mm01_00134228 predicted 282
11 SASI_Mm01_00134224 predicted 629
12 SASI_Mm01_00134229 predicted 866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133497
KCNV2 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily V, member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133497.2-1682s1c1
Sequence:CCGGTCCATCCTCTACAACAAGTTTCTCGAGAAACTTGTTGTAGAGGATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133497.2-691s1c1
Sequence:CCGGGCTGGTCTACAATTTCTACCTCTCGAGAGGTAGAAATTGTAGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133497.2-1654s1c1
Sequence:CCGGTGGGATCATTCTCAACGGGATCTCGAGATCCCGTTGAGAATGATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133497.2-841s1c1
Sequence:CCGGGCTGAGCGAACGGCTCAAGATCTCGAGATCTTGAGCCGTTCGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133497.2-260s21c1
Sequence:CCGGTGGAACACGACGGAGAATGAGCTCGAGCTCATTCTCCGTCGTGTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133497.2-640s21c1
Sequence:CCGGCGAGGAGCAGACAGACGAATACTCGAGTATTCGTCTGTCTGCTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133497.2-1720s21c1
Sequence:CCGGGCTGAAGGCTTATGAGTATACCTCGAGGTATACTCATAAGCCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133497.2-1794s21c1
Sequence:CCGGAGATAGCTGAGTGTTTGCTTGCTCGAGCAAGCAAACACTCAGCTATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133497
KCNV2 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily V, member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133497.2-1682s1c1
Sequence:CCGGTCCATCCTCTACAACAAGTTTCTCGAGAAACTTGTTGTAGAGGATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133497.2-691s1c1
Sequence:CCGGGCTGGTCTACAATTTCTACCTCTCGAGAGGTAGAAATTGTAGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133497.2-1654s1c1
Sequence:CCGGTGGGATCATTCTCAACGGGATCTCGAGATCCCGTTGAGAATGATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133497.2-841s1c1
Sequence:CCGGGCTGAGCGAACGGCTCAAGATCTCGAGATCTTGAGCCGTTCGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133497.2-260s21c1
Sequence:CCGGTGGAACACGACGGAGAATGAGCTCGAGCTCATTCTCCGTCGTGTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133497.2-640s21c1
Sequence:CCGGCGAGGAGCAGACAGACGAATACTCGAGTATTCGTCTGTCTGCTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133497.2-1720s21c1
Sequence:CCGGGCTGAAGGCTTATGAGTATACCTCGAGGTATACTCATAAGCCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133497.2-1794s21c1
Sequence:CCGGAGATAGCTGAGTGTTTGCTTGCTCGAGCAAGCAAACACTCAGCTATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133497
KCNV2 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily V, member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133497.2-1682s1c1
Sequence:CCGGTCCATCCTCTACAACAAGTTTCTCGAGAAACTTGTTGTAGAGGATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133497.2-691s1c1
Sequence:CCGGGCTGGTCTACAATTTCTACCTCTCGAGAGGTAGAAATTGTAGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133497.2-1654s1c1
Sequence:CCGGTGGGATCATTCTCAACGGGATCTCGAGATCCCGTTGAGAATGATCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133497.2-841s1c1
Sequence:CCGGGCTGAGCGAACGGCTCAAGATCTCGAGATCTTGAGCCGTTCGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133497.2-260s21c1
Sequence:CCGGTGGAACACGACGGAGAATGAGCTCGAGCTCATTCTCCGTCGTGTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133497.2-640s21c1
Sequence:CCGGCGAGGAGCAGACAGACGAATACTCGAGTATTCGTCTGTCTGCTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133497.2-1720s21c1
Sequence:CCGGGCTGAAGGCTTATGAGTATACCTCGAGGTATACTCATAAGCCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133497.2-1794s21c1
Sequence:CCGGAGATAGCTGAGTGTTTGCTTGCTCGAGCAAGCAAACACTCAGCTATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183179
KCNV2 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily V, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183179.1-297s1c1
Sequence:CCGGCGAGGGCAACTACAATTACTACTCGAGTAGTAATTGTAGTTGCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183179.1-1766s1c1
Sequence:CCGGTGGCTGAATGTTTATCTGAAACTCGAGTTTCAGATAAACATTCAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183179.1-3158s1c1
Sequence:CCGGGCTGGTTAGTTCTCGTCAATACTCGAGTATTGACGAGAACTAACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183179.1-1674s1c1
Sequence:CCGGCGATTACTACAGCAAGCTCAACTCGAGTTGAGCTTGCTGTAGTAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183179.1-422s1c1
Sequence:CCGGACAACGATACTCCAGCCCAAACTCGAGTTTGGGCTGGAGTATCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183179
KCNV2 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily V, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183179.1-297s1c1
Sequence:CCGGCGAGGGCAACTACAATTACTACTCGAGTAGTAATTGTAGTTGCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183179.1-1766s1c1
Sequence:CCGGTGGCTGAATGTTTATCTGAAACTCGAGTTTCAGATAAACATTCAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183179.1-3158s1c1
Sequence:CCGGGCTGGTTAGTTCTCGTCAATACTCGAGTATTGACGAGAACTAACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183179.1-1674s1c1
Sequence:CCGGCGATTACTACAGCAAGCTCAACTCGAGTTGAGCTTGCTGTAGTAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183179.1-422s1c1
Sequence:CCGGACAACGATACTCCAGCCCAAACTCGAGTTTGGGCTGGAGTATCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183179
KCNV2 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily V, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183179.1-297s1c1
Sequence:CCGGCGAGGGCAACTACAATTACTACTCGAGTAGTAATTGTAGTTGCCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183179.1-1766s1c1
Sequence:CCGGTGGCTGAATGTTTATCTGAAACTCGAGTTTCAGATAAACATTCAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183179.1-3158s1c1
Sequence:CCGGGCTGGTTAGTTCTCGTCAATACTCGAGTATTGACGAGAACTAACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183179.1-1674s1c1
Sequence:CCGGCGATTACTACAGCAAGCTCAACTCGAGTTGAGCTTGCTGTAGTAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183179.1-422s1c1
Sequence:CCGGACAACGATACTCCAGCCCAAACTCGAGTTTGGGCTGGAGTATCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)