EMAIL THIS PAGE TO A FRIEND

KCP

kielin/chordin-like protein

79 Gene Product Result for
Synonyms: CRIM2 KCP1 NET67
UniProtKB ID: Q6ZWJ8, Q8NBE0
Gene ID:
Mouse(333088) kielin/chordin-like protein
Rat(296952) kielin/chordin-like protein
dog(482265) kielin/chordin-like protein
domestic cat(101084785) kielin/chordin-like protein
domestic guinea pig(100718420) kielin/chordin-like protein
naked mole-rat(101719068) kielin/chordin-like protein
sheep(101105154) kielin/chordin-like protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199349 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001029985 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029985 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029985 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001128429 Rosetta Predictions human pricing
XM_001715223 Rosetta Predictions human pricing
XM_001715714 Rosetta Predictions human pricing
XM_929907 Rosetta Predictions human pricing
XM_001064164 Rosetta Predictions rat pricing
XM_231561 Rosetta Predictions rat pricing
NM_001029985 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001128429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00384885 predicted 893
2 SASI_Hs02_00384886 predicted 538
3 SASI_Hs02_00384887 predicted 1840
4 SASI_Hs02_00384888 predicted 1896
5 SASI_Hs02_00384889 predicted 1842
6 SASI_Hs02_00384890 predicted 604
7 SASI_Hs02_00384891 predicted 639
8 SASI_Hs02_00384892 predicted 1915
9 SASI_Hs02_00384893 predicted 1841
10 SASI_Hs02_00384894 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00402262 predicted 3588
2 SASI_Hs02_00402263 predicted 3764
3 SASI_Hs02_00402264 predicted 773
4 SASI_Hs02_00402265 predicted 4130
5 SASI_Hs02_00402266 predicted 2807
6 SASI_Hs02_00402267 predicted 3174
7 SASI_Hs02_00402268 predicted 2892
8 SASI_Hs02_00402269 predicted 3313
9 SASI_Hs02_00402270 predicted 226
10 SASI_Hs02_00402271 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00405619 predicted 896
2 SASI_Hs02_00405620 predicted 534
3 SASI_Hs02_00405621 predicted 1802
4 SASI_Hs02_00405622 predicted 1072
5 SASI_Hs02_00405623 predicted 595
6 SASI_Hs02_00405624 predicted 634
7 SASI_Hs02_00405625 predicted 1877
8 SASI_Hs02_00405626 predicted 1029
9 SASI_Hs02_00405627 predicted 1806
10 SASI_Hs02_00405628 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289053 predicted 4013
2 SASI_Hs01_00289054 predicted 4188
3 SASI_Hs01_00289055 predicted 998
4 SASI_Hs01_00289056 predicted 3035
5 SASI_Hs01_00289057 predicted 3398
6 SASI_Hs01_00289058 predicted 3117
7 SASI_Hs01_00289059 predicted 1167
8 SASI_Hs01_00289060 predicted 2407
9 SASI_Hs01_00289061 predicted 4112
10 SASI_Hs01_00289062 predicted 4194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064164 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309549 predicted 2218
2 SASI_Rn02_00309550 predicted 1018
3 SASI_Rn02_00309551 predicted 4507
4 SASI_Rn02_00309552 predicted 2619
5 SASI_Rn02_00309553 predicted 3745
6 SASI_Rn02_00309554 predicted 2185
7 SASI_Rn02_00309555 predicted 2346
8 SASI_Rn02_00309556 predicted 2638
9 SASI_Rn02_00309557 predicted 888
10 SASI_Rn02_00309558 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386831 predicted 4291
2 SASI_Rn02_00386832 predicted 1019
3 SASI_Rn02_00386833 predicted 4506
4 SASI_Rn02_00386834 predicted 3931
5 SASI_Rn02_00386835 predicted 1099
6 SASI_Rn02_00386836 predicted 644
7 SASI_Rn02_00386837 predicted 604
8 SASI_Rn02_00386838 predicted 690
9 SASI_Rn02_00386839 predicted 932
10 SASI_Rn02_00386840 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113850 predicted 2338
2 SASI_Mm02_00288086 predicted 4461
3 SASI_Mm02_00288087 predicted 3744
4 SASI_Mm01_00113851 predicted 523
5 SASI_Mm01_00113852 predicted 3112
6 SASI_Mm01_00113853 predicted 3332
7 SASI_Mm02_00288088 predicted 4246
8 SASI_Mm01_00113854 predicted 1019
9 SASI_Mm01_00113855 predicted 1620
10 SASI_Mm01_00113856 predicted 3927
11 SASI_Mm01_00113857 predicted 1120
12 SASI_Mm01_00113858 predicted 1561
13 SASI_Mm01_00113859 predicted 425
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199349
KCP MISSION shRNA Bacterial Glycerol Stock
kielin/chordin-like protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199349.2-956s21c1
Sequence:CCGGCCTGTGTGTGATGGCTGTTTCCTCGAGGAAACAGCCATCACACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199349.2-606s21c1
Sequence:CCGGGTAAGCCAGGCTGTGATTATGCTCGAGCATAATCACAGCCTGGCTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199349.2-1494s21c1
Sequence:CCGGCCTACCACAGCCAAGTGTATGCTCGAGCATACACTTGGCTGTGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199349.2-2452s21c1
Sequence:CCGGCTGCCCTAGGGTGGATCTAAACTCGAGTTTAGATCCACCCTAGGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199349.2-2426s21c1
Sequence:CCGGAGAGGGCTGGGTCAGAATAATCTCGAGATTATTCTGACCCAGCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199349
KCP MISSION shRNA shRNA Plasmid DNA
kielin/chordin-like protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199349.2-956s21c1
Sequence:CCGGCCTGTGTGTGATGGCTGTTTCCTCGAGGAAACAGCCATCACACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199349.2-606s21c1
Sequence:CCGGGTAAGCCAGGCTGTGATTATGCTCGAGCATAATCACAGCCTGGCTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199349.2-1494s21c1
Sequence:CCGGCCTACCACAGCCAAGTGTATGCTCGAGCATACACTTGGCTGTGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199349.2-2452s21c1
Sequence:CCGGCTGCCCTAGGGTGGATCTAAACTCGAGTTTAGATCCACCCTAGGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199349.2-2426s21c1
Sequence:CCGGAGAGGGCTGGGTCAGAATAATCTCGAGATTATTCTGACCCAGCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199349
KCP MISSION shRNA Lentiviral Transduction Particles
kielin/chordin-like protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199349.2-956s21c1
Sequence:CCGGCCTGTGTGTGATGGCTGTTTCCTCGAGGAAACAGCCATCACACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199349.2-606s21c1
Sequence:CCGGGTAAGCCAGGCTGTGATTATGCTCGAGCATAATCACAGCCTGGCTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199349.2-1494s21c1
Sequence:CCGGCCTACCACAGCCAAGTGTATGCTCGAGCATACACTTGGCTGTGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199349.2-2452s21c1
Sequence:CCGGCTGCCCTAGGGTGGATCTAAACTCGAGTTTAGATCCACCCTAGGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199349.2-2426s21c1
Sequence:CCGGAGAGGGCTGGGTCAGAATAATCTCGAGATTATTCTGACCCAGCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029985
KCP MISSION shRNA Bacterial Glycerol Stock
kielin/chordin-like protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029985.1-1210s1c1
Sequence:CCGGGCTGGTGAAGTATCCTGTGAACTCGAGTTCACAGGATACTTCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029985.1-3123s1c1
Sequence:CCGGGTGTGAAGTGTGCATCTGCAACTCGAGTTGCAGATGCACACTTCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029985.1-2345s1c1
Sequence:CCGGCTGCCTGTGATAGCTGTGATTCTCGAGAATCACAGCTATCACAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029985.1-4600s1c1
Sequence:CCGGGCTGAGTTAAGAATACCCATACTCGAGTATGGGTATTCTTAACTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029985.1-1491s1c1
Sequence:CCGGGTATGCTAATGGGCAGAACTTCTCGAGAAGTTCTGCCCATTAGCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029985
KCP MISSION shRNA shRNA Plasmid DNA
kielin/chordin-like protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029985.1-1210s1c1
Sequence:CCGGGCTGGTGAAGTATCCTGTGAACTCGAGTTCACAGGATACTTCACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029985.1-3123s1c1
Sequence:CCGGGTGTGAAGTGTGCATCTGCAACTCGAGTTGCAGATGCACACTTCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029985.1-2345s1c1
Sequence:CCGGCTGCCTGTGATAGCTGTGATTCTCGAGAATCACAGCTATCACAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029985.1-4600s1c1
Sequence:CCGGGCTGAGTTAAGAATACCCATACTCGAGTATGGGTATTCTTAACTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029985.1-1491s1c1
Sequence:CCGGGTATGCTAATGGGCAGAACTTCTCGAGAAGTTCTGCCCATTAGCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029985
KCP MISSION shRNA Lentiviral Transduction Particles
kielin/chordin-like protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029985.1-1210s1c1
Sequence:CCGGGCTGGTGAAGTATCCTGTGAACTCGAGTTCACAGGATACTTCACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029985.1-3123s1c1
Sequence:CCGGGTGTGAAGTGTGCATCTGCAACTCGAGTTGCAGATGCACACTTCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029985.1-2345s1c1
Sequence:CCGGCTGCCTGTGATAGCTGTGATTCTCGAGAATCACAGCTATCACAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029985.1-4600s1c1
Sequence:CCGGGCTGAGTTAAGAATACCCATACTCGAGTATGGGTATTCTTAACTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029985.1-1491s1c1
Sequence:CCGGGTATGCTAATGGGCAGAACTTCTCGAGAAGTTCTGCCCATTAGCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)