EMAIL THIS PAGE TO A FRIEND

KCTD10

potassium channel tetramerization domain containing 10

53 Gene Product Result for
Synonyms: BTBD28 ULRO61 hBACURD3
UniProtKB ID: Q9H3F6, Q53HN2, Q59FV1, Q6PL47, Q96SU0
Gene ID:
Mouse(330171) potassium channel tetramerisation domain containing 10
Rat(494521) potassium channel tetramerization domain containing 10
domestic guinea pig(100718718) potassium channel tetramerization domain containing 10
naked mole-rat(101710166) potassium channel tetramerisation domain containing 10
sheep(101114309) potassium channel tetramerisation domain containing 10
Zebrafish(406787) potassium channel tetramerisation domain containing 10
cow(540881) potassium channel tetramerisation domain containing 10
domestic cat(101086182) potassium channel tetramerisation domain containing 10
dog(486312) potassium channel tetramerisation domain containing 10
chicken(416900) potassium channel tetramerisation domain containing 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107927 Anti-KCTD10 antibody produced in rabbit IgG fraction of antiserum horse, guinea pig, canine, human, rabbit, zebrafish, rat, pig, bovine, mouse
western blot pricing
HPA014273 Anti-KCTD10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV35370 Anti-KCTD10 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder human, zebrafish, mouse, bovine, rat, canine
western blot pricing
SAB2104219 Anti-KCTD10 antibody produced in rabbit affinity isolated antibody zebrafish, guinea pig, horse, rabbit, rat, mouse, human, bovine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031954 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031954 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031954 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026145 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026145 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026145 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031954 Rosetta Predictions human pricing
NM_001009973 Rosetta Predictions rat pricing
NM_026145 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108591 predicted 1315
2 SASI_Hs01_00108592 predicted 1272
3 SASI_Hs01_00108593 predicted 1144
4 SASI_Hs01_00108594 predicted 419
5 SASI_Hs01_00108595 predicted 1233
6 SASI_Hs02_00359125 predicted 334
7 SASI_Hs02_00359126 predicted 686
8 SASI_Hs01_00108600 predicted 1224
9 SASI_Hs02_00359127 predicted 763
10 SASI_Hs02_00359128 predicted 759
11 SASI_Hs01_00108596 predicted 481
12 SASI_Hs01_00108597 predicted 828
13 SASI_Hs01_00108598 predicted 601
14 SASI_Hs01_00108599 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040635 predicted 1240
2 SASI_Rn01_00040636 predicted 649
3 SASI_Rn01_00040637 predicted 547
4 SASI_Rn01_00040638 predicted 1073
5 SASI_Rn02_00199808 predicted 548
6 SASI_Rn01_00040639 predicted 756
7 SASI_Rn01_00040640 predicted 503
8 SASI_Rn01_00040642 predicted 1015
9 SASI_Rn02_00199809 predicted 648
10 SASI_Rn01_00040643 predicted 765
11 SASI_Rn01_00040641 predicted 869
12 SASI_Rn01_00040644 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026145 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197373 predicted 564
2 SASI_Mm01_00197374 predicted 1093
3 SASI_Mm01_00197375 predicted 663
4 SASI_Mm01_00197376 predicted 1246
5 SASI_Mm01_00197377 predicted 284
6 SASI_Mm01_00197378 predicted 779
7 SASI_Mm01_00197379 predicted 1261
8 SASI_Mm01_00197380 predicted 487
9 SASI_Mm01_00197381 predicted 706
10 SASI_Mm01_00197382 predicted 624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031954
VALIDATED
KCTD10 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031954.3-1472s21c1
Sequence:CCGGGAGCTCCCTGCTTCCTATTTCCTCGAGGAAATAGGAAGCAGGGAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031954.3-658s21c1
Sequence:CCGCTAAGCTGTCTCTGCGCTTTAACTCGAGTTAAAGCGCAGAGACAGCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031954.3-690s21c1
Sequence:CCGGTGTTCATAAAGGATGTTATTGCTCGAGCAATAACATCCTTTATGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031954.3-1175s21c1
Sequence:CCGGATTGCTTGACAAGGCAAATTGCTCGAGCAATTTGCCTTGTCAAGCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031954.2-635s1c1
Sequence:CCGGCCTGTTCATAAAGGATGTCATCTCGAGATGACATCCTTTATGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031954.2-281s1c1
Sequence:CCGGGCACTTTGGTACGATACTCAACTCGAGTTGAGTATCGTACCAAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031954.2-521s1c1
Sequence:CCGGGTTGCTCTACAACAGAAGTAACTCGAGTTACTTCTGTTGTAGAGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031954.2-713s1c1
Sequence:CCGGCTGTTGTACCTCCATCGTCTACTCGAGTAGACGATGGAGGTACAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031954.2-369s1c1
Sequence:CCGGGCCAAGTACTACCTAGTCCAACTCGAGTTGGACTAGGTAGTACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031954
VALIDATED
KCTD10 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031954.3-1472s21c1
Sequence:CCGGGAGCTCCCTGCTTCCTATTTCCTCGAGGAAATAGGAAGCAGGGAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031954.3-658s21c1
Sequence:CCGCTAAGCTGTCTCTGCGCTTTAACTCGAGTTAAAGCGCAGAGACAGCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031954.3-690s21c1
Sequence:CCGGTGTTCATAAAGGATGTTATTGCTCGAGCAATAACATCCTTTATGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031954.3-1175s21c1
Sequence:CCGGATTGCTTGACAAGGCAAATTGCTCGAGCAATTTGCCTTGTCAAGCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031954.2-635s1c1
Sequence:CCGGCCTGTTCATAAAGGATGTCATCTCGAGATGACATCCTTTATGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031954.2-281s1c1
Sequence:CCGGGCACTTTGGTACGATACTCAACTCGAGTTGAGTATCGTACCAAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031954.2-521s1c1
Sequence:CCGGGTTGCTCTACAACAGAAGTAACTCGAGTTACTTCTGTTGTAGAGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031954.2-713s1c1
Sequence:CCGGCTGTTGTACCTCCATCGTCTACTCGAGTAGACGATGGAGGTACAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031954.2-369s1c1
Sequence:CCGGGCCAAGTACTACCTAGTCCAACTCGAGTTGGACTAGGTAGTACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031954
VALIDATED
KCTD10 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442952    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031954.3-1472s21c1
Sequence:CCGGGAGCTCCCTGCTTCCTATTTCCTCGAGGAAATAGGAAGCAGGGAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031954.3-658s21c1
Sequence:CCGCTAAGCTGTCTCTGCGCTTTAACTCGAGTTAAAGCGCAGAGACAGCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031954.3-690s21c1
Sequence:CCGGTGTTCATAAAGGATGTTATTGCTCGAGCAATAACATCCTTTATGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031954.3-1175s21c1
Sequence:CCGGATTGCTTGACAAGGCAAATTGCTCGAGCAATTTGCCTTGTCAAGCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031954.2-635s1c1
Sequence:CCGGCCTGTTCATAAAGGATGTCATCTCGAGATGACATCCTTTATGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031954.2-281s1c1
Sequence:CCGGGCACTTTGGTACGATACTCAACTCGAGTTGAGTATCGTACCAAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031954.2-521s1c1
Sequence:CCGGGTTGCTCTACAACAGAAGTAACTCGAGTTACTTCTGTTGTAGAGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031954.2-713s1c1
Sequence:CCGGCTGTTGTACCTCCATCGTCTACTCGAGTAGACGATGGAGGTACAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031954.2-369s1c1
Sequence:CCGGGCCAAGTACTACCTAGTCCAACTCGAGTTGGACTAGGTAGTACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026145
KCTD10 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 10
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.3-495s21c1
Sequence:CCGGGGCTTATAGCGACGTCAAATACTCGAGTATTTGACGTCGCTATAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026145.3-1308s21c1
Sequence:CCGGTGGGTGTTGACTACCTATTAGCTCGAGCTAATAGGTAGTCAACACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.3-671s21c1
Sequence:CCGGGAGATCTGCTGTTGGTCATTTCTCGAGAAATGACCAACAGCAGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.3-772s21c1
Sequence:CCGGGTTCCCTGAAGCCCGCATTTACTCGAGTAAATGCGGGCTTCAGGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.3-937s21c1
Sequence:CCGGCGTGAGGAGGATCCATATCAACTCGAGTTGATATGGATCCTCCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.4-530s21c1
Sequence:CCGGGCTTATAGCGACGTCAAATAACTCGAGTTATTTGACGTCGCTATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.4-600s21c1
Sequence:CCGGACCAGCAATTCTGACGATAACCTCGAGGTTATCGTCAGAATTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.4-807s21c1
Sequence:CCGGTTCCCTGAAGCCCGCATTTATCTCGAGATAAATGCGGGCTTCAGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026145.4-1291s21c1
Sequence:CCGGTGAATGAGTTTGGCGTGTATGCTCGAGCATACACGCCAAACTCATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026145.2-644s1c1
Sequence:CCGGCCTGTTCATTAAGGACGTCATCTCGAGATGACGTCCTTAATGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026145.2-164s1c1
Sequence:CCGGCGCTCTCTACTACACCACCATCTCGAGATGGTGGTGTAGTAGAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026145.2-938s1c1
Sequence:CCGGCGTGAGGAGGATCCATATCAACTCGAGTTGATATGGATCCTCCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026145.2-434s1c1
Sequence:CCGGCAAAGATACTTACGAGCCCTTCTCGAGAAGGGCTCGTAAGTATCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026145.2-566s1c1
Sequence:CCGGCACCAGCAATTCTGACGATAACTCGAGTTATCGTCAGAATTGCTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026145
KCTD10 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 10
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.3-495s21c1
Sequence:CCGGGGCTTATAGCGACGTCAAATACTCGAGTATTTGACGTCGCTATAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026145.3-1308s21c1
Sequence:CCGGTGGGTGTTGACTACCTATTAGCTCGAGCTAATAGGTAGTCAACACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.3-671s21c1
Sequence:CCGGGAGATCTGCTGTTGGTCATTTCTCGAGAAATGACCAACAGCAGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.3-772s21c1
Sequence:CCGGGTTCCCTGAAGCCCGCATTTACTCGAGTAAATGCGGGCTTCAGGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.3-937s21c1
Sequence:CCGGCGTGAGGAGGATCCATATCAACTCGAGTTGATATGGATCCTCCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.4-530s21c1
Sequence:CCGGGCTTATAGCGACGTCAAATAACTCGAGTTATTTGACGTCGCTATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.4-600s21c1
Sequence:CCGGACCAGCAATTCTGACGATAACCTCGAGGTTATCGTCAGAATTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.4-807s21c1
Sequence:CCGGTTCCCTGAAGCCCGCATTTATCTCGAGATAAATGCGGGCTTCAGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026145.4-1291s21c1
Sequence:CCGGTGAATGAGTTTGGCGTGTATGCTCGAGCATACACGCCAAACTCATTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026145.2-644s1c1
Sequence:CCGGCCTGTTCATTAAGGACGTCATCTCGAGATGACGTCCTTAATGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026145.2-164s1c1
Sequence:CCGGCGCTCTCTACTACACCACCATCTCGAGATGGTGGTGTAGTAGAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026145.2-938s1c1
Sequence:CCGGCGTGAGGAGGATCCATATCAACTCGAGTTGATATGGATCCTCCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026145.2-434s1c1
Sequence:CCGGCAAAGATACTTACGAGCCCTTCTCGAGAAGGGCTCGTAAGTATCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026145.2-566s1c1
Sequence:CCGGCACCAGCAATTCTGACGATAACTCGAGTTATCGTCAGAATTGCTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026145
KCTD10 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 10
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.3-495s21c1
Sequence:CCGGGGCTTATAGCGACGTCAAATACTCGAGTATTTGACGTCGCTATAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026145.3-1308s21c1
Sequence:CCGGTGGGTGTTGACTACCTATTAGCTCGAGCTAATAGGTAGTCAACACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.3-671s21c1
Sequence:CCGGGAGATCTGCTGTTGGTCATTTCTCGAGAAATGACCAACAGCAGATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.3-772s21c1
Sequence:CCGGGTTCCCTGAAGCCCGCATTTACTCGAGTAAATGCGGGCTTCAGGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.3-937s21c1
Sequence:CCGGCGTGAGGAGGATCCATATCAACTCGAGTTGATATGGATCCTCCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.4-530s21c1
Sequence:CCGGGCTTATAGCGACGTCAAATAACTCGAGTTATTTGACGTCGCTATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.4-600s21c1
Sequence:CCGGACCAGCAATTCTGACGATAACCTCGAGGTTATCGTCAGAATTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026145.4-807s21c1
Sequence:CCGGTTCCCTGAAGCCCGCATTTATCTCGAGATAAATGCGGGCTTCAGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026145.4-1291s21c1
Sequence:CCGGTGAATGAGTTTGGCGTGTATGCTCGAGCATACACGCCAAACTCATTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026145.2-644s1c1
Sequence:CCGGCCTGTTCATTAAGGACGTCATCTCGAGATGACGTCCTTAATGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026145.2-164s1c1
Sequence:CCGGCGCTCTCTACTACACCACCATCTCGAGATGGTGGTGTAGTAGAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026145.2-938s1c1
Sequence:CCGGCGTGAGGAGGATCCATATCAACTCGAGTTGATATGGATCCTCCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026145.2-434s1c1
Sequence:CCGGCAAAGATACTTACGAGCCCTTCTCGAGAAGGGCTCGTAAGTATCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026145.2-566s1c1
Sequence:CCGGCACCAGCAATTCTGACGATAACTCGAGTTATCGTCAGAATTGCTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)