EMAIL THIS PAGE TO A FRIEND

KCTD14

potassium channel tetramerization domain containing 14

69 Gene Product Result for
UniProtKB ID: Q9BQ13
Gene ID:
Mouse(233529) potassium channel tetramerisation domain containing 14
Rat(308836) potassium channel tetramerization domain containing 14
chicken(419029) potassium channel tetramerisation domain containing 14
dog(485170) potassium channel tetramerisation domain containing 14
cow(100297610) potassium channel tetramerization domain containing 14
domestic cat(101086500) potassium channel tetramerisation domain containing 14
domestic guinea pig(100733217) potassium channel tetramerization domain containing 14
naked mole-rat(101726153) potassium channel tetramerisation domain containing 14
sheep(101116522) potassium channel tetramerisation domain containing 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023930 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023930 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023930 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001012434 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001012434 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001012434 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003631 MISSION® esiRNA esiRNA targeting human KCTD14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023930 Rosetta Predictions human pricing
XM_001064247 Rosetta Predictions rat pricing
XM_218935 Rosetta Predictions rat pricing
NM_001010826 Rosetta Predictions mouse pricing
NM_001012434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199854 predicted 969
2 SASI_Hs02_00356394 predicted 201
3 SASI_Hs01_00199856 predicted 965
4 SASI_Hs01_00199857 predicted 896
5 SASI_Hs01_00199858 predicted 493
6 SASI_Hs01_00199859 predicted 810
7 SASI_Hs01_00199860 predicted 932
8 SASI_Hs01_00199861 predicted 933
9 SASI_Hs01_00199862 predicted 936
10 SASI_Hs01_00199863 predicted 979
11 SASI_Hs01_00199855 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064247 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00309784 predicted 456
2 SASI_Rn02_00309785 predicted 506
3 SASI_Rn02_00309786 predicted 1021
4 SASI_Rn02_00309787 predicted 1079
5 SASI_Rn02_00309788 predicted 965
6 SASI_Rn02_00309789 predicted 434
7 SASI_Rn02_00309790 predicted 927
8 SASI_Rn02_00309791 predicted 880
9 SASI_Rn02_00309792 predicted 468
10 SASI_Rn02_00309793 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218935 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378177 predicted 933
2 SASI_Rn02_00378178 predicted 1020
3 SASI_Rn02_00378179 predicted 835
4 SASI_Rn02_00378180 predicted 1078
5 SASI_Rn02_00378181 predicted 868
6 SASI_Rn02_00378182 predicted 1083
7 SASI_Rn02_00378183 predicted 1087
8 SASI_Rn02_00378184 predicted 974
9 SASI_Rn02_00378185 predicted 932
10 SASI_Rn02_00378186 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194935 predicted 770
2 SASI_Mm01_00194936 predicted 618
3 SASI_Mm01_00194937 predicted 772
4 SASI_Mm01_00194938 predicted 607
5 SASI_Mm01_00194939 predicted 387
6 SASI_Mm01_00194940 predicted 759
7 SASI_Mm01_00194941 predicted 265
8 SASI_Mm01_00194942 predicted 223
9 SASI_Mm01_00194944 predicted 368
10 SASI_Mm02_00286893 predicted 439
11 SASI_Mm01_00194943 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130482 predicted 989
2 SASI_Mm01_00130483 predicted 374
3 SASI_Mm01_00130484 predicted 986
4 SASI_Mm01_00130485 predicted 602
5 SASI_Mm01_00130486 predicted 675
6 SASI_Mm01_00130487 predicted 472
7 SASI_Mm01_00130488 predicted 430
8 SASI_Mm01_00130489 predicted 579
9 SASI_Mm01_00130490 predicted 821
10 SASI_Mm01_00130491 predicted 690
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023930
KCTD14 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 14
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023930.3-669s21c1
Sequence:CCGGACTGCCTGGAGATGGACATTACTCGAGTAATGTCCATCTCCAGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023930.3-609s21c1
Sequence:CCGGTCAAGTCTGTTGTCAAGTTTGCTCGAGCAAACTTGACAACAGACTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023930.3-959s21c1
Sequence:CCGGTGCAACTGATGCCACTATATTCTCGAGAATATAGTGGCATCAGTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023930.3-179s21c1
Sequence:CCGGAGGAAGTTTCCGGGCTCAAAGCTCGAGCTTTGAGCCCGGAAACTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023930.3-393s21c1
Sequence:CCGGAGGACATGCCACAGATCTTTGCTCGAGCAAAGATCTGTGGCATGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023930.3-552s21c1
Sequence:CCGGAGGAGCAGGATGCATATTATTCTCGAGAATAATATGCATCCTGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023930.3-905s21c1
Sequence:CCGGTCTAGAGTCTTGCCACTAAATCTCGAGATTTAGTGGCAAGACTCTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023930.3-109s21c1
Sequence:CCGGGCCAACGATGTCTACTGTTGTCTCGAGACAACAGTAGACATCGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023930.2-669s1c1
Sequence:CCGGCAAGGTATTCTCCAAGTTCTACTCGAGTAGAACTTGGAGAATACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023930.2-612s1c1
Sequence:CCGGCCTAGACAACAGCGACCTCATCTCGAGATGAGGTCGCTGTTGTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023930.2-465s1c1
Sequence:CCGGAGAAGCCATAACAGCACGGAACTCGAGTTCCGTGCTGTTATGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023930.2-169s1c1
Sequence:CCGGGCAGAGATGTTCTCTAGCTTACTCGAGTAAGCTAGAGAACATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023930.2-324s1c1
Sequence:CCGGGTTCTACGAAATCAAGCCTTTCTCGAGAAAGGCTTGATTTCGTAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023930
KCTD14 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 14
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023930.3-669s21c1
Sequence:CCGGACTGCCTGGAGATGGACATTACTCGAGTAATGTCCATCTCCAGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023930.3-609s21c1
Sequence:CCGGTCAAGTCTGTTGTCAAGTTTGCTCGAGCAAACTTGACAACAGACTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023930.3-959s21c1
Sequence:CCGGTGCAACTGATGCCACTATATTCTCGAGAATATAGTGGCATCAGTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023930.3-179s21c1
Sequence:CCGGAGGAAGTTTCCGGGCTCAAAGCTCGAGCTTTGAGCCCGGAAACTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023930.3-393s21c1
Sequence:CCGGAGGACATGCCACAGATCTTTGCTCGAGCAAAGATCTGTGGCATGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023930.3-552s21c1
Sequence:CCGGAGGAGCAGGATGCATATTATTCTCGAGAATAATATGCATCCTGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023930.3-905s21c1
Sequence:CCGGTCTAGAGTCTTGCCACTAAATCTCGAGATTTAGTGGCAAGACTCTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023930.3-109s21c1
Sequence:CCGGGCCAACGATGTCTACTGTTGTCTCGAGACAACAGTAGACATCGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023930.2-669s1c1
Sequence:CCGGCAAGGTATTCTCCAAGTTCTACTCGAGTAGAACTTGGAGAATACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023930.2-612s1c1
Sequence:CCGGCCTAGACAACAGCGACCTCATCTCGAGATGAGGTCGCTGTTGTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023930.2-465s1c1
Sequence:CCGGAGAAGCCATAACAGCACGGAACTCGAGTTCCGTGCTGTTATGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023930.2-169s1c1
Sequence:CCGGGCAGAGATGTTCTCTAGCTTACTCGAGTAAGCTAGAGAACATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023930.2-324s1c1
Sequence:CCGGGTTCTACGAAATCAAGCCTTTCTCGAGAAAGGCTTGATTTCGTAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023930
KCTD14 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 14
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023930.3-669s21c1
Sequence:CCGGACTGCCTGGAGATGGACATTACTCGAGTAATGTCCATCTCCAGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023930.3-609s21c1
Sequence:CCGGTCAAGTCTGTTGTCAAGTTTGCTCGAGCAAACTTGACAACAGACTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023930.3-959s21c1
Sequence:CCGGTGCAACTGATGCCACTATATTCTCGAGAATATAGTGGCATCAGTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023930.3-179s21c1
Sequence:CCGGAGGAAGTTTCCGGGCTCAAAGCTCGAGCTTTGAGCCCGGAAACTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023930.3-393s21c1
Sequence:CCGGAGGACATGCCACAGATCTTTGCTCGAGCAAAGATCTGTGGCATGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023930.3-552s21c1
Sequence:CCGGAGGAGCAGGATGCATATTATTCTCGAGAATAATATGCATCCTGCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370265    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023930.3-905s21c1
Sequence:CCGGTCTAGAGTCTTGCCACTAAATCTCGAGATTTAGTGGCAAGACTCTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023930.3-109s21c1
Sequence:CCGGGCCAACGATGTCTACTGTTGTCTCGAGACAACAGTAGACATCGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023930.2-669s1c1
Sequence:CCGGCAAGGTATTCTCCAAGTTCTACTCGAGTAGAACTTGGAGAATACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023930.2-612s1c1
Sequence:CCGGCCTAGACAACAGCGACCTCATCTCGAGATGAGGTCGCTGTTGTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023930.2-465s1c1
Sequence:CCGGAGAAGCCATAACAGCACGGAACTCGAGTTCCGTGCTGTTATGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023930.2-169s1c1
Sequence:CCGGGCAGAGATGTTCTCTAGCTTACTCGAGTAAGCTAGAGAACATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023930.2-324s1c1
Sequence:CCGGGTTCTACGAAATCAAGCCTTTCTCGAGAAAGGCTTGATTTCGTAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012434
KCTD14 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 14
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000181415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012434.1-990s1c1
Sequence:CCGGCCCTACACTTGCTTCTGGATACTCGAGTATCCAGAAGCAAGTGTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012434.1-703s1c1
Sequence:CCGGGAGTGCCAAACTACAGAGAAACTCGAGTTTCTCTGTAGTTTGGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012434.1-897s1c1
Sequence:CCGGCCTATGACGGAGGACTTTGTACTCGAGTACAAAGTCCTCCGTCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012434.1-473s1c1
Sequence:CCGGCAGGTCAGCTAGACACTACAACTCGAGTTGTAGTGTCTAGCTGACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012434
KCTD14 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 14
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000181415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012434.1-990s1c1
Sequence:CCGGCCCTACACTTGCTTCTGGATACTCGAGTATCCAGAAGCAAGTGTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012434.1-703s1c1
Sequence:CCGGGAGTGCCAAACTACAGAGAAACTCGAGTTTCTCTGTAGTTTGGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012434.1-897s1c1
Sequence:CCGGCCTATGACGGAGGACTTTGTACTCGAGTACAAAGTCCTCCGTCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012434.1-473s1c1
Sequence:CCGGCAGGTCAGCTAGACACTACAACTCGAGTTGTAGTGTCTAGCTGACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012434
KCTD14 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 14
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000181415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012434.1-990s1c1
Sequence:CCGGCCCTACACTTGCTTCTGGATACTCGAGTATCCAGAAGCAAGTGTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012434.1-703s1c1
Sequence:CCGGGAGTGCCAAACTACAGAGAAACTCGAGTTTCTCTGTAGTTTGGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012434.1-897s1c1
Sequence:CCGGCCTATGACGGAGGACTTTGTACTCGAGTACAAAGTCCTCCGTCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012434.1-473s1c1
Sequence:CCGGCAGGTCAGCTAGACACTACAACTCGAGTTGTAGTGTCTAGCTGACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)