EMAIL THIS PAGE TO A FRIEND

KCTD15

potassium channel tetramerization domain containing 15

112 Gene Product Result for
UniProtKB ID: Q96SI1, A8K600, Q9BVI6
Gene ID:
Mouse(233107) potassium channel tetramerisation domain containing 15
Rat(499129) potassium channel tetramerization domain containing 15
sheep(101111479) potassium channel tetramerisation domain containing 15
domestic guinea pig(100721595) potassium channel tetramerization domain containing 15
naked mole-rat(101724605) potassium channel tetramerisation domain containing 15
chicken(415779) potassium channel tetramerisation domain containing 15
dog(484595) potassium channel tetramerisation domain containing 15
cow(512578) potassium channel tetramerisation domain containing 15
domestic cat(101090310) potassium channel tetramerisation domain containing 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1400693 Anti-KCTD15 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2101234 Anti-KCTD15 antibody produced in rabbit affinity isolated antibody zebrafish, mouse, rat, canine, rabbit, horse, guinea pig, bovine, human
western blot pricing
SAB3500386 Anti-KCTD15 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA050822 Anti-KCTD15 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146188 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146188 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146188 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024076 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU057291 MISSION® esiRNA esiRNA targeting mouse Kctd15 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024076 Rosetta Predictions human pricing
NM_001109141 Rosetta Predictions rat pricing
NM_146188 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084194 predicted 1184
2 SASI_Hs01_00084195 predicted 973
3 SASI_Hs01_00084196 predicted 804
4 SASI_Hs01_00084197 predicted 617
5 SASI_Hs01_00084198 predicted 1236
6 SASI_Hs01_00084199 predicted 1219
7 SASI_Hs01_00084200 predicted 537
8 SASI_Hs01_00084201 predicted 928
9 SASI_Hs01_00084202 predicted 1003
10 SASI_Hs01_00084203 predicted 320
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245530 predicted 565
2 SASI_Rn02_00245531 predicted 566
3 SASI_Rn02_00245532 predicted 983
4 SASI_Rn02_00245533 predicted 848
5 SASI_Rn02_00245534 predicted 1222
6 SASI_Rn02_00245535 predicted 1476
7 SASI_Rn02_00245536 predicted 1588
8 SASI_Rn02_00245537 predicted 359
9 SASI_Rn02_00245538 predicted 1454
10 SASI_Rn02_00245539 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146188 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193890 predicted 622
2 SASI_Mm01_00193891 predicted 554
3 SASI_Mm01_00193892 predicted 571
4 SASI_Mm01_00193893 predicted 1091
5 SASI_Mm01_00193894 predicted 1461
6 SASI_Mm02_00341885 predicted 1199
7 SASI_Mm01_00193895 predicted 1546
8 SASI_Mm01_00193897 predicted 835
9 SASI_Mm01_00193898 predicted 556
10 SASI_Mm01_00193899 predicted 840
11 SASI_Mm01_00193896 predicted 965
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146188
VALIDATED
KCTD15 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 15
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146188.1-2280s1c1
Sequence:CCGGCCCTTGTGTATAACGCCTGTACTCGAGTACAGGCGTTATACACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146188.1-976s1c1
Sequence:CCGGCAGGTCCTAGAAAGGCTGTTTCTCGAGAAACAGCCTTTCTAGGACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146188.1-1057s1c1
Sequence:CCGGGAATATGTTCTTTGCCGGGAACTCGAGTTCCCGGCAAAGAACATATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146188.1-568s1c1
Sequence:CCGGGACAGTCTCAAGCAACATTATCTCGAGATAATGTTGCTTGAGACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146188.1-522s1c1
Sequence:CCGGCTCCAGAATAAGCCGTCTCTTCTCGAGAAGAGACGGCTTATTCTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146188.1-1190s21c1
Sequence:CCGGACATGGAAATAGCGCTGAGGACTCGAGTCCTCAGCGCTATTTCCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146188.1-345s21c1
Sequence:CCGGCACGGCGGAGGGAGGAAATATCTCGAGATATTTCCTCCCTCCGCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146188.1-878s21c1
Sequence:CCGGGAGACGTCATGTGCAACTCTGCTCGAGCAGAGTTGCACATGACGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146188.1-1333s21c1
Sequence:CCGGGGGTTGATGTGACCTGGTTGACTCGAGTCAACCAGGTCACATCAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146188.1-941s21c1
Sequence:CCGGTCCCTCTCAACGGCTACTGTACTCGAGTACAGTAGCCGTTGAGAGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146188.1-627s21c1
Sequence:CCGGGAGTTTCCTGCGGACGTCAAACTCGAGTTTGACGTCCGCAGGAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146188.1-818s21c1
Sequence:CCGGGTGAACGGATCGCACTCAGTGCTCGAGCACTGAGTGCGATCCGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146188.1-461s21c1
Sequence:CCGGACATCGATGTGGGAGGTCACACTCGAGTGTGACCTCCCACATCGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146188
VALIDATED
KCTD15 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 15
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146188.1-2280s1c1
Sequence:CCGGCCCTTGTGTATAACGCCTGTACTCGAGTACAGGCGTTATACACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146188.1-976s1c1
Sequence:CCGGCAGGTCCTAGAAAGGCTGTTTCTCGAGAAACAGCCTTTCTAGGACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146188.1-1057s1c1
Sequence:CCGGGAATATGTTCTTTGCCGGGAACTCGAGTTCCCGGCAAAGAACATATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146188.1-568s1c1
Sequence:CCGGGACAGTCTCAAGCAACATTATCTCGAGATAATGTTGCTTGAGACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146188.1-522s1c1
Sequence:CCGGCTCCAGAATAAGCCGTCTCTTCTCGAGAAGAGACGGCTTATTCTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146188.1-1190s21c1
Sequence:CCGGACATGGAAATAGCGCTGAGGACTCGAGTCCTCAGCGCTATTTCCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146188.1-345s21c1
Sequence:CCGGCACGGCGGAGGGAGGAAATATCTCGAGATATTTCCTCCCTCCGCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146188.1-878s21c1
Sequence:CCGGGAGACGTCATGTGCAACTCTGCTCGAGCAGAGTTGCACATGACGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146188.1-1333s21c1
Sequence:CCGGGGGTTGATGTGACCTGGTTGACTCGAGTCAACCAGGTCACATCAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146188.1-941s21c1
Sequence:CCGGTCCCTCTCAACGGCTACTGTACTCGAGTACAGTAGCCGTTGAGAGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146188.1-627s21c1
Sequence:CCGGGAGTTTCCTGCGGACGTCAAACTCGAGTTTGACGTCCGCAGGAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146188.1-818s21c1
Sequence:CCGGGTGAACGGATCGCACTCAGTGCTCGAGCACTGAGTGCGATCCGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146188.1-461s21c1
Sequence:CCGGACATCGATGTGGGAGGTCACACTCGAGTGTGACCTCCCACATCGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146188
VALIDATED
KCTD15 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 15
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146188.1-2280s1c1
Sequence:CCGGCCCTTGTGTATAACGCCTGTACTCGAGTACAGGCGTTATACACAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146188.1-976s1c1
Sequence:CCGGCAGGTCCTAGAAAGGCTGTTTCTCGAGAAACAGCCTTTCTAGGACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146188.1-1057s1c1
Sequence:CCGGGAATATGTTCTTTGCCGGGAACTCGAGTTCCCGGCAAAGAACATATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146188.1-568s1c1
Sequence:CCGGGACAGTCTCAAGCAACATTATCTCGAGATAATGTTGCTTGAGACTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146188.1-522s1c1
Sequence:CCGGCTCCAGAATAAGCCGTCTCTTCTCGAGAAGAGACGGCTTATTCTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146188.1-1190s21c1
Sequence:CCGGACATGGAAATAGCGCTGAGGACTCGAGTCCTCAGCGCTATTTCCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146188.1-345s21c1
Sequence:CCGGCACGGCGGAGGGAGGAAATATCTCGAGATATTTCCTCCCTCCGCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146188.1-878s21c1
Sequence:CCGGGAGACGTCATGTGCAACTCTGCTCGAGCAGAGTTGCACATGACGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146188.1-1333s21c1
Sequence:CCGGGGGTTGATGTGACCTGGTTGACTCGAGTCAACCAGGTCACATCAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146188.1-941s21c1
Sequence:CCGGTCCCTCTCAACGGCTACTGTACTCGAGTACAGTAGCCGTTGAGAGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146188.1-627s21c1
Sequence:CCGGGAGTTTCCTGCGGACGTCAAACTCGAGTTTGACGTCCGCAGGAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146188.1-818s21c1
Sequence:CCGGGTGAACGGATCGCACTCAGTGCTCGAGCACTGAGTGCGATCCGTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146188.1-461s21c1
Sequence:CCGGACATCGATGTGGGAGGTCACACTCGAGTGTGACCTCCCACATCGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024076
VALIDATED
KCTD15 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 15
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000043780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_024076.1-479s1c1
Sequence:CCGGAGTACCCTGACTCCAGGATAACTCGAGTTATCCTGGAGTCAGGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024076.1-792s1c1
Sequence:CCGGGATCGCACTCAGCGGCGAGAACTCGAGTTCTCGCCGCTGAGTGCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024076.1-928s1c1
Sequence:CCGGCGGCTCAACTCGGTACAGGATCTCGAGATCCTGTACCGAGTTGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024076.1-624s1c1
Sequence:CCGGTCCGGATGACTTTAAGGACTTCTCGAGAAGTCCTTAAAGTCATCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024076
VALIDATED
KCTD15 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 15
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000043780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_024076.1-479s1c1
Sequence:CCGGAGTACCCTGACTCCAGGATAACTCGAGTTATCCTGGAGTCAGGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024076.1-792s1c1
Sequence:CCGGGATCGCACTCAGCGGCGAGAACTCGAGTTCTCGCCGCTGAGTGCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024076.1-928s1c1
Sequence:CCGGCGGCTCAACTCGGTACAGGATCTCGAGATCCTGTACCGAGTTGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024076.1-624s1c1
Sequence:CCGGTCCGGATGACTTTAAGGACTTCTCGAGAAGTCCTTAAAGTCATCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024076
VALIDATED
KCTD15 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 15
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000043780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_024076.1-479s1c1
Sequence:CCGGAGTACCCTGACTCCAGGATAACTCGAGTTATCCTGGAGTCAGGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_024076.1-792s1c1
Sequence:CCGGGATCGCACTCAGCGGCGAGAACTCGAGTTCTCGCCGCTGAGTGCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024076.1-928s1c1
Sequence:CCGGCGGCTCAACTCGGTACAGGATCTCGAGATCCTGTACCGAGTTGAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024076.1-624s1c1
Sequence:CCGGTCCGGATGACTTTAAGGACTTCTCGAGAAGTCCTTAAAGTCATCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)