EMAIL THIS PAGE TO A FRIEND

KCTD16

potassium channel tetramerization domain containing 16

228 Gene Product Result for
UniProtKB ID: Q68DU8, Q9P2M9
Gene ID:
Mouse(383348) potassium channel tetramerisation domain containing 16
Rat(291618) potassium channel tetramerization domain containing 16
chicken(427644) potassium channel tetramerisation domain containing 16
cow(527830) potassium channel tetramerisation domain containing 16
Horse(100072042) potassium channel tetramerisation domain containing 16
dog(487196) potassium channel tetramerisation domain containing 16
domestic cat(101081783) potassium channel tetramerisation domain containing 16
domestic guinea pig(100731603) potassium channel tetramerization domain containing 16
naked mole-rat(101725692) potassium channel tetramerisation domain containing 16
sheep(101110839) potassium channel tetramerisation domain containing 16
Domestic Rabbit(100357562) potassium channel tetramerisation domain containing 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_356997 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_356997 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_356997 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020768 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020768 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020768 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020768 Rosetta Predictions human pricing
XM_001069498 Rosetta Predictions rat pricing
XM_225971 Rosetta Predictions rat pricing
XM_001479017 Rosetta Predictions mouse pricing
XM_909931 Rosetta Predictions mouse pricing
XM_993798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020768 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093476 predicted 1394
2 SASI_Hs01_00093478 predicted 1118
3 SASI_Hs01_00093479 predicted 859
4 SASI_Hs01_00093480 predicted 1495
5 SASI_Hs01_00093481 predicted 637
6 SASI_Hs01_00093482 predicted 746
7 SASI_Hs01_00093483 predicted 1211
8 SASI_Hs01_00093484 predicted 794
9 SASI_Hs01_00093485 predicted 1413
10 SASI_Hs02_00353899 predicted 651
11 SASI_Hs01_00093477 predicted 973
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328264 predicted 238
2 SASI_Rn02_00328265 predicted 977
3 SASI_Rn02_00328266 predicted 426
4 SASI_Rn02_00328267 predicted 874
5 SASI_Rn02_00328268 predicted 1106
6 SASI_Rn02_00328269 predicted 985
7 SASI_Rn02_00328270 predicted 536
8 SASI_Rn02_00328271 predicted 787
9 SASI_Rn02_00328272 predicted 212
10 SASI_Rn02_00328273 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225971 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383300 predicted 247
2 SASI_Rn02_00383301 predicted 978
3 SASI_Rn02_00383302 predicted 283
4 SASI_Rn02_00383303 predicted 869
5 SASI_Rn02_00383304 predicted 1109
6 SASI_Rn02_00383305 predicted 989
7 SASI_Rn02_00383306 predicted 536
8 SASI_Rn02_00383307 predicted 785
9 SASI_Rn02_00383308 predicted 220
10 SASI_Rn02_00383309 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00407057 predicted 238
2 SASI_Mm02_00407058 predicted 1357
3 SASI_Mm02_00407059 predicted 866
4 SASI_Mm02_00407060 predicted 805
5 SASI_Mm02_00407061 predicted 792
6 SASI_Mm02_00407062 predicted 969
7 SASI_Mm02_00407063 predicted 219
8 SASI_Mm02_00407064 predicted 1360
9 SASI_Mm02_00407065 predicted 581
10 SASI_Mm02_00407066 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_909931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435203 predicted 242
2 SASI_Mm02_00435204 predicted 1348
3 SASI_Mm02_00435205 predicted 870
4 SASI_Mm02_00435206 predicted 807
5 SASI_Mm02_00435207 predicted 786
6 SASI_Mm02_00435208 predicted 977
7 SASI_Mm02_00435209 predicted 217
8 SASI_Mm02_00435210 predicted 1367
9 SASI_Mm02_00435211 predicted 579
10 SASI_Mm02_00435212 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_993798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00240790 predicted 959
2 SASI_Mm01_00240791 predicted 475
3 SASI_Mm01_00240792 predicted 719
4 SASI_Mm01_00240793 predicted 823
5 SASI_Mm01_00240794 predicted 585
6 SASI_Mm01_00240795 predicted 668
7 SASI_Mm01_00240796 predicted 970
8 SASI_Mm01_00240797 predicted 796
9 SASI_Mm01_00240798 predicted 963
10 SASI_Mm01_00240799 predicted 579
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_356997
KCTD16 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356997.1-283s1c1
Sequence:CCGGGAAGTCATAGAGCTGAATGTTCTCGAGAACATTCAGCTCTATGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356997.1-866s1c1
Sequence:CCGGCAGAAAGATACACCTCCAGATCTCGAGATCTGGAGGTGTATCTTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356997.1-453s1c1
Sequence:CCGGGTTCCGTTATATTCTGGACTACTCGAGTAGTCCAGAATATAACGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356997.1-795s1c1
Sequence:CCGGCGGAAGAATTTCCTTGGCAAACTCGAGTTTGCCAAGGAAATTCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356997.1-58s1c1
Sequence:CCGGCCGATTATTACATCCTGTGAACTCGAGTTCACAGGATGTAATAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_356997
KCTD16 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356997.1-283s1c1
Sequence:CCGGGAAGTCATAGAGCTGAATGTTCTCGAGAACATTCAGCTCTATGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356997.1-866s1c1
Sequence:CCGGCAGAAAGATACACCTCCAGATCTCGAGATCTGGAGGTGTATCTTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356997.1-453s1c1
Sequence:CCGGGTTCCGTTATATTCTGGACTACTCGAGTAGTCCAGAATATAACGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356997.1-795s1c1
Sequence:CCGGCGGAAGAATTTCCTTGGCAAACTCGAGTTTGCCAAGGAAATTCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356997.1-58s1c1
Sequence:CCGGCCGATTATTACATCCTGTGAACTCGAGTTCACAGGATGTAATAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_356997
KCTD16 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356997.1-283s1c1
Sequence:CCGGGAAGTCATAGAGCTGAATGTTCTCGAGAACATTCAGCTCTATGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356997.1-866s1c1
Sequence:CCGGCAGAAAGATACACCTCCAGATCTCGAGATCTGGAGGTGTATCTTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356997.1-453s1c1
Sequence:CCGGGTTCCGTTATATTCTGGACTACTCGAGTAGTCCAGAATATAACGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356997.1-795s1c1
Sequence:CCGGCGGAAGAATTTCCTTGGCAAACTCGAGTTTGCCAAGGAAATTCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356997.1-58s1c1
Sequence:CCGGCCGATTATTACATCCTGTGAACTCGAGTTCACAGGATGTAATAATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020768
KCTD16 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 16
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020768.1-916s1c1
Sequence:CCGGCTGCCTGATCACTTTCCAGAACTCGAGTTCTGGAAAGTGATCAGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020768.1-3955s1c1
Sequence:CCGGGCAAAGAATCACAGAGCTTAACTCGAGTTAAGCTCTGTGATTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020768.1-1753s1c1
Sequence:CCGGGAATCGAACATGAGCAGCAAACTCGAGTTTGCTGCTCATGTTCGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020768.1-1686s1c1
Sequence:CCGGGCTGATCCAACAGTCAGAGATCTCGAGATCTCTGACTGTTGGATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020768.1-810s1c1
Sequence:CCGGCACGGCTAATGATCTAGCCAACTCGAGTTGGCTAGATCATTAGCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020768.1-1059s1c1
Sequence:CCGGCCAAGGAAGCGACACAAGAATCTCGAGATTCTTGTGTCGCTTCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020768.1-873s1c1
Sequence:CCGGGTTCCGTTATATTCTGGACTACTCGAGTAGTCCAGAATATAACGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020768
KCTD16 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 16
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020768.1-916s1c1
Sequence:CCGGCTGCCTGATCACTTTCCAGAACTCGAGTTCTGGAAAGTGATCAGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020768.1-3955s1c1
Sequence:CCGGGCAAAGAATCACAGAGCTTAACTCGAGTTAAGCTCTGTGATTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020768.1-1753s1c1
Sequence:CCGGGAATCGAACATGAGCAGCAAACTCGAGTTTGCTGCTCATGTTCGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020768.1-1686s1c1
Sequence:CCGGGCTGATCCAACAGTCAGAGATCTCGAGATCTCTGACTGTTGGATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020768.1-810s1c1
Sequence:CCGGCACGGCTAATGATCTAGCCAACTCGAGTTGGCTAGATCATTAGCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020768.1-1059s1c1
Sequence:CCGGCCAAGGAAGCGACACAAGAATCTCGAGATTCTTGTGTCGCTTCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020768.1-873s1c1
Sequence:CCGGGTTCCGTTATATTCTGGACTACTCGAGTAGTCCAGAATATAACGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020768
KCTD16 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 16
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020768.1-916s1c1
Sequence:CCGGCTGCCTGATCACTTTCCAGAACTCGAGTTCTGGAAAGTGATCAGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020768.1-3955s1c1
Sequence:CCGGGCAAAGAATCACAGAGCTTAACTCGAGTTAAGCTCTGTGATTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020768.1-1753s1c1
Sequence:CCGGGAATCGAACATGAGCAGCAAACTCGAGTTTGCTGCTCATGTTCGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020768.1-1686s1c1
Sequence:CCGGGCTGATCCAACAGTCAGAGATCTCGAGATCTCTGACTGTTGGATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020768.1-810s1c1
Sequence:CCGGCACGGCTAATGATCTAGCCAACTCGAGTTGGCTAGATCATTAGCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020768.1-1059s1c1
Sequence:CCGGCCAAGGAAGCGACACAAGAATCTCGAGATTCTTGTGTCGCTTCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020768.1-873s1c1
Sequence:CCGGGTTCCGTTATATTCTGGACTACTCGAGTAGTCCAGAATATAACGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)