EMAIL THIS PAGE TO A FRIEND

KCTD19

potassium channel tetramerization domain containing 19

76 Gene Product Result for
UniProtKB ID: Q17RG1, B4DZ49, Q8N804
Gene ID:
Mouse(279499) potassium channel tetramerisation domain containing 19
Rat(291965) potassium channel tetramerization domain containing 19
chicken(769782) potassium channel tetramerisation domain containing 19
cow(523858) potassium channel tetramerisation domain containing 19
domestic cat(101099853) potassium channel tetramerisation domain containing 19
dog(479689) potassium channel tetramerisation domain containing 19
sheep(101113002) potassium channel tetramerisation domain containing 19
domestic guinea pig(100731575) potassium channel tetramerization domain containing 19
naked mole-rat(101700138) potassium channel tetramerisation domain containing 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177791 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177791 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177791 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001100915 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001100915 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001100915 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100915 Rosetta Predictions human pricing
XM_085367 Rosetta Predictions human pricing
XM_001075666 Rosetta Predictions rat pricing
XM_226403 Rosetta Predictions rat pricing
NM_177791 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322525 predicted 1111
2 SASI_Hs02_00322526 predicted 1406
3 SASI_Hs02_00322527 predicted 1486
4 SASI_Hs02_00322528 predicted 226
5 SASI_Hs02_00322529 predicted 727
6 SASI_Hs02_00322530 predicted 1134
7 SASI_Hs02_00322531 predicted 1961
8 SASI_Hs02_00322532 predicted 251
9 SASI_Hs02_00322533 predicted 1172
10 SASI_Hs02_00322534 predicted 2448
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_085367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268100 predicted 493
2 SASI_Hs01_00268101 predicted 452
3 SASI_Hs01_00268102 predicted 265
4 SASI_Hs01_00268103 predicted 290
5 SASI_Hs01_00268104 predicted 258
6 SASI_Hs01_00268105 predicted 523
7 SASI_Hs01_00268106 predicted 253
8 SASI_Hs01_00268107 predicted 469
9 SASI_Hs01_00268108 predicted 238
10 SASI_Hs01_00268109 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350625 predicted 528
2 SASI_Rn02_00350626 predicted 1310
3 SASI_Rn02_00350627 predicted 1101
4 SASI_Rn02_00350628 predicted 1875
5 SASI_Rn02_00350629 predicted 237
6 SASI_Rn02_00350630 predicted 856
7 SASI_Rn02_00350631 predicted 790
8 SASI_Rn02_00350632 predicted 755
9 SASI_Rn02_00350633 predicted 1676
10 SASI_Rn02_00350634 predicted 1154
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383523 predicted 529
2 SASI_Rn02_00383524 predicted 1312
3 SASI_Rn02_00383525 predicted 1105
4 SASI_Rn02_00383526 predicted 1879
5 SASI_Rn02_00383527 predicted 240
6 SASI_Rn02_00383528 predicted 859
7 SASI_Rn02_00383529 predicted 790
8 SASI_Rn02_00383530 predicted 756
9 SASI_Rn02_00383531 predicted 1676
10 SASI_Rn02_00383532 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133591 predicted 217
2 SASI_Mm01_00133592 predicted 1802
3 SASI_Mm01_00133593 predicted 1386
4 SASI_Mm01_00133594 predicted 1942
5 SASI_Mm01_00133595 predicted 386
6 SASI_Mm01_00133596 predicted 1220
7 SASI_Mm01_00133597 predicted 1860
8 SASI_Mm01_00133598 predicted 752
9 SASI_Mm01_00133599 predicted 1432
10 SASI_Mm02_00348234 predicted 1186
11 SASI_Mm01_00133600 predicted 1568
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177791
KCTD19 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 19
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177791.2-328s1c1
Sequence:CCGGCCTTGCTTCAGACCCTAGATACTCGAGTATCTAGGGTCTGAAGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177791.2-1190s1c1
Sequence:CCGGGCCAATGAAAGTGGCTCTGAACTCGAGTTCAGAGCCACTTTCATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177791.2-776s1c1
Sequence:CCGGGCTTACAGAAGCTGTACGGTTCTCGAGAACCGTACAGCTTCTGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177791.2-2858s21c1
Sequence:CCGGTTCAGTCCTGGGCAAGTATTTCTCGAGAAATACTTGCCCAGGACTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177791.2-2359s21c1
Sequence:CCGGATGCTAACGGGACCGACAATCCTCGAGGATTGTCGGTCCCGTTAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177791.2-1940s21c1
Sequence:CCGGGAAGAAGTGCACCACTATAAACTCGAGTTTATAGTGGTGCACTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177791.2-224s21c1
Sequence:CCGGGTTTAGGCATGTGCACTATTACTCGAGTAATAGTGCACATGCCTAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177791.2-1265s21c1
Sequence:CCGGGACAGCTGAGGTCACGATATACTCGAGTATATCGTGACCTCAGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177791
KCTD19 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 19
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177791.2-328s1c1
Sequence:CCGGCCTTGCTTCAGACCCTAGATACTCGAGTATCTAGGGTCTGAAGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177791.2-1190s1c1
Sequence:CCGGGCCAATGAAAGTGGCTCTGAACTCGAGTTCAGAGCCACTTTCATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177791.2-776s1c1
Sequence:CCGGGCTTACAGAAGCTGTACGGTTCTCGAGAACCGTACAGCTTCTGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177791.2-2858s21c1
Sequence:CCGGTTCAGTCCTGGGCAAGTATTTCTCGAGAAATACTTGCCCAGGACTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177791.2-2359s21c1
Sequence:CCGGATGCTAACGGGACCGACAATCCTCGAGGATTGTCGGTCCCGTTAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177791.2-1940s21c1
Sequence:CCGGGAAGAAGTGCACCACTATAAACTCGAGTTTATAGTGGTGCACTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177791.2-224s21c1
Sequence:CCGGGTTTAGGCATGTGCACTATTACTCGAGTAATAGTGCACATGCCTAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177791.2-1265s21c1
Sequence:CCGGGACAGCTGAGGTCACGATATACTCGAGTATATCGTGACCTCAGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177791
KCTD19 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 19
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201490    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177791.2-328s1c1
Sequence:CCGGCCTTGCTTCAGACCCTAGATACTCGAGTATCTAGGGTCTGAAGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177791.2-1190s1c1
Sequence:CCGGGCCAATGAAAGTGGCTCTGAACTCGAGTTCAGAGCCACTTTCATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177791.2-776s1c1
Sequence:CCGGGCTTACAGAAGCTGTACGGTTCTCGAGAACCGTACAGCTTCTGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177791.2-2858s21c1
Sequence:CCGGTTCAGTCCTGGGCAAGTATTTCTCGAGAAATACTTGCCCAGGACTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177791.2-2359s21c1
Sequence:CCGGATGCTAACGGGACCGACAATCCTCGAGGATTGTCGGTCCCGTTAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177791.2-1940s21c1
Sequence:CCGGGAAGAAGTGCACCACTATAAACTCGAGTTTATAGTGGTGCACTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177791.2-224s21c1
Sequence:CCGGGTTTAGGCATGTGCACTATTACTCGAGTAATAGTGCACATGCCTAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177791.2-1265s21c1
Sequence:CCGGGACAGCTGAGGTCACGATATACTCGAGTATATCGTGACCTCAGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100915
KCTD19 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 19
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100915.1-586s21c1
Sequence:CCGGCTAGACCTGGTGGCCAAATATCTCGAGATATTTGGCCACCAGGTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100915.1-1327s21c1
Sequence:CCGGAGAGTGTACTGGATCACATATCTCGAGATATGTGATCCAGTACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100915.1-237s21c1
Sequence:CCGGATTTAGGCACGTGCACTATTACTCGAGTAATAGTGCACGTGCCTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100915.1-728s21c1
Sequence:CCGGCGGATAATTTCTCCAACATTGCTCGAGCAATGTTGGAGAAATTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100915.1-2192s21c1
Sequence:CCGGCAACCTTCAAGCCATACTTACCTCGAGGTAAGTATGGCTTGAAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100915
KCTD19 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 19
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100915.1-586s21c1
Sequence:CCGGCTAGACCTGGTGGCCAAATATCTCGAGATATTTGGCCACCAGGTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100915.1-1327s21c1
Sequence:CCGGAGAGTGTACTGGATCACATATCTCGAGATATGTGATCCAGTACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100915.1-237s21c1
Sequence:CCGGATTTAGGCACGTGCACTATTACTCGAGTAATAGTGCACGTGCCTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100915.1-728s21c1
Sequence:CCGGCGGATAATTTCTCCAACATTGCTCGAGCAATGTTGGAGAAATTATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100915.1-2192s21c1
Sequence:CCGGCAACCTTCAAGCCATACTTACCTCGAGGTAAGTATGGCTTGAAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100915
KCTD19 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 19
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100915.1-586s21c1
Sequence:CCGGCTAGACCTGGTGGCCAAATATCTCGAGATATTTGGCCACCAGGTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100915.1-1327s21c1
Sequence:CCGGAGAGTGTACTGGATCACATATCTCGAGATATGTGATCCAGTACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100915.1-237s21c1
Sequence:CCGGATTTAGGCACGTGCACTATTACTCGAGTAATAGTGCACGTGCCTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100915.1-728s21c1
Sequence:CCGGCGGATAATTTCTCCAACATTGCTCGAGCAATGTTGGAGAAATTATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100915.1-2192s21c1
Sequence:CCGGCAACCTTCAAGCCATACTTACCTCGAGGTAAGTATGGCTTGAAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)