EMAIL THIS PAGE TO A FRIEND

KCTD1

potassium channel tetramerization domain containing 1

145 Gene Product Result for
Synonyms: C18orf5 SENS
UniProtKB ID: Q719H9, A8K1F5
Gene ID:
Mouse(106931) potassium channel tetramerisation domain containing 1
Rat(291772) potassium channel tetramerization domain containing 1
Zebrafish(555637) potassium channel tetramerisation domain containing 1
dog(480170) potassium channel tetramerisation domain containing 1
cow(784587) potassium channel tetramerisation domain containing 1
domestic cat(101080744) potassium channel tetramerisation domain containing 1
chicken(421087) potassium channel tetramerisation domain containing 1
Goat(100861009) potassium channel tetramerisation domain containing 1
sheep(101117127) potassium channel tetramerisation domain containing 1
naked mole-rat(101702216) potassium channel tetramerisation domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198991 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198991 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198991 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_355081 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355081 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355081 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001142731 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001142731 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001142731 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198991 Rosetta Predictions human pricing
XM_001055957 Rosetta Predictions rat pricing
XM_001062225 Rosetta Predictions rat pricing
XM_001062284 Rosetta Predictions rat pricing
XM_214617 Rosetta Predictions rat pricing
NM_134112 Rosetta Predictions mouse pricing
XM_980194 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233666 predicted 604
2 SASI_Hs01_00233667 predicted 767
3 SASI_Hs01_00233668 predicted 651
4 SASI_Hs02_00372504 predicted 884
5 SASI_Hs01_00233670 predicted 346
6 SASI_Hs01_00233671 predicted 294
7 SASI_Hs01_00233672 predicted 447
8 SASI_Hs01_00233673 predicted 428
9 SASI_Hs01_00233674 predicted 445
10 SASI_Hs01_00233675 predicted 349
11 SASI_Hs01_00233669 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281579 predicted 704
2 SASI_Rn02_00281580 predicted 641
3 SASI_Rn02_00281581 predicted 768
4 SASI_Rn02_00281582 predicted 518
5 SASI_Rn02_00281583 predicted 528
6 SASI_Rn02_00281584 predicted 357
7 SASI_Rn02_00281585 predicted 446
8 SASI_Rn02_00281586 predicted 220
9 SASI_Rn02_00281587 predicted 224
10 SASI_Rn02_00281588 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062225 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302738 predicted 1016
2 SASI_Rn02_00302739 predicted 956
3 SASI_Rn02_00302740 predicted 1072
4 SASI_Rn02_00302741 predicted 820
5 SASI_Rn02_00302742 predicted 836
6 SASI_Rn02_00302743 predicted 658
7 SASI_Rn02_00302744 predicted 756
8 SASI_Rn02_00302745 predicted 530
9 SASI_Rn02_00302746 predicted 528
10 SASI_Rn02_00302747 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062284 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302936 predicted 704
2 SASI_Rn02_00302937 predicted 649
3 SASI_Rn02_00302938 predicted 767
4 SASI_Rn02_00302939 predicted 517
5 SASI_Rn02_00302940 predicted 528
6 SASI_Rn02_00302941 predicted 356
7 SASI_Rn02_00302942 predicted 453
8 SASI_Rn02_00302943 predicted 223
9 SASI_Rn02_00302944 predicted 221
10 SASI_Rn02_00302945 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214617 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375445 predicted 1010
2 SASI_Rn02_00375446 predicted 951
3 SASI_Rn02_00375447 predicted 1077
4 SASI_Rn02_00375448 predicted 826
5 SASI_Rn02_00375449 predicted 837
6 SASI_Rn02_00375450 predicted 658
7 SASI_Rn02_00375451 predicted 751
8 SASI_Rn02_00375452 predicted 525
9 SASI_Rn02_00375453 predicted 529
10 SASI_Rn02_00375454 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134112 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339346 predicted 307
2 SASI_Mm02_00339347 predicted 338
3 SASI_Mm02_00339348 predicted 710
4 SASI_Mm02_00339349 predicted 439
5 SASI_Mm02_00339350 predicted 347
6 SASI_Mm02_00339351 predicted 443
7 SASI_Mm02_00339352 predicted 453
8 SASI_Mm02_00339353 predicted 696
9 SASI_Mm02_00339354 predicted 328
10 SASI_Mm02_00339355 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_980194 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213925 predicted 251
2 SASI_Mm01_00213926 predicted 789
3 SASI_Mm01_00213927 predicted 337
4 SASI_Mm01_00213928 predicted 821
5 SASI_Mm01_00213929 predicted 608
6 SASI_Mm01_00213930 predicted 328
7 SASI_Mm01_00213931 predicted 1452
8 SASI_Mm01_00213932 predicted 1416
9 SASI_Mm01_00213933 predicted 303
10 SASI_Mm01_00213934 predicted 402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198991
VALIDATED
KCTD1 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_198991.1-666s1c1
Sequence:CCGGCGTGATGTGTAACTCTGTCAACTCGAGTTGACAGAGTTACACATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_198991.1-706s1c1
Sequence:CCGGTCGACGCACGTCATCAGGTTTCTCGAGAAACCTGATGACGTGCGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_198991.1-832s1c1
Sequence:CCGGCAGTTCAGCGAATACGTCCTTCTCGAGAAGGACGTATTCGCTGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_198991.1-502s1c1
Sequence:CCGGCCCATGTTGTTGGAGATGGAACTCGAGTTCCATCTCCAACAACATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_198991.1-287s1c1
Sequence:CCGGCCCTCACCAAATACCCTGAATCTCGAGATTCAGGGTATTTGGTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198991.2-1090s21c1
Sequence:CCGGGTGATATCCTCAAGGTGTAAACTCGAGTTTACACCTTGAGGATATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198991.2-1391s21c1
Sequence:CCGGTATGGAGGTTCCACGTCTTTCCTCGAGGAAAGACGTGGAACCTCCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198991
VALIDATED
KCTD1 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_198991.1-666s1c1
Sequence:CCGGCGTGATGTGTAACTCTGTCAACTCGAGTTGACAGAGTTACACATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_198991.1-706s1c1
Sequence:CCGGTCGACGCACGTCATCAGGTTTCTCGAGAAACCTGATGACGTGCGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_198991.1-832s1c1
Sequence:CCGGCAGTTCAGCGAATACGTCCTTCTCGAGAAGGACGTATTCGCTGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_198991.1-502s1c1
Sequence:CCGGCCCATGTTGTTGGAGATGGAACTCGAGTTCCATCTCCAACAACATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_198991.1-287s1c1
Sequence:CCGGCCCTCACCAAATACCCTGAATCTCGAGATTCAGGGTATTTGGTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198991.2-1090s21c1
Sequence:CCGGGTGATATCCTCAAGGTGTAAACTCGAGTTTACACCTTGAGGATATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198991.2-1391s21c1
Sequence:CCGGTATGGAGGTTCCACGTCTTTCCTCGAGGAAAGACGTGGAACCTCCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198991
VALIDATED
KCTD1 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_198991.1-666s1c1
Sequence:CCGGCGTGATGTGTAACTCTGTCAACTCGAGTTGACAGAGTTACACATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_198991.1-706s1c1
Sequence:CCGGTCGACGCACGTCATCAGGTTTCTCGAGAAACCTGATGACGTGCGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_198991.1-832s1c1
Sequence:CCGGCAGTTCAGCGAATACGTCCTTCTCGAGAAGGACGTATTCGCTGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_198991.1-502s1c1
Sequence:CCGGCCCATGTTGTTGGAGATGGAACTCGAGTTCCATCTCCAACAACATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_198991.1-287s1c1
Sequence:CCGGCCCTCACCAAATACCCTGAATCTCGAGATTCAGGGTATTTGGTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198991.2-1090s21c1
Sequence:CCGGGTGATATCCTCAAGGTGTAAACTCGAGTTTACACCTTGAGGATATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198991.2-1391s21c1
Sequence:CCGGTATGGAGGTTCCACGTCTTTCCTCGAGGAAAGACGTGGAACCTCCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355081
VALIDATED
KCTD1 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355081.1-1537s1c1
Sequence:CCGGCCACTGAACAACCAAGGCATTCTCGAGAATGCCTTGGTTGTTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_355081.1-1795s1c1
Sequence:CCGGCCTGATGATTTCAAGGACTATCTCGAGATAGTCCTTGAAATCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355081.1-1002s1c1
Sequence:CCGGGCTGTCCAAGACCTACACTAACTCGAGTTAGTGTAGGTCTTGGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_355081.1-2125s1c1
Sequence:CCGGCGGTTGCAGCAAAGAGGATTTCTCGAGAAATCCTCTTTGCTGCAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355081.1-696s1c1
Sequence:CCGGCGGTCGCAAGTTCGTTTACTTCTCGAGAAGTAAACGAACTTGCGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355081
VALIDATED
KCTD1 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355081.1-1537s1c1
Sequence:CCGGCCACTGAACAACCAAGGCATTCTCGAGAATGCCTTGGTTGTTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_355081.1-1795s1c1
Sequence:CCGGCCTGATGATTTCAAGGACTATCTCGAGATAGTCCTTGAAATCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355081.1-1002s1c1
Sequence:CCGGGCTGTCCAAGACCTACACTAACTCGAGTTAGTGTAGGTCTTGGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_355081.1-2125s1c1
Sequence:CCGGCGGTTGCAGCAAAGAGGATTTCTCGAGAAATCCTCTTTGCTGCAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355081.1-696s1c1
Sequence:CCGGCGGTCGCAAGTTCGTTTACTTCTCGAGAAGTAAACGAACTTGCGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355081
VALIDATED
KCTD1 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355081.1-1537s1c1
Sequence:CCGGCCACTGAACAACCAAGGCATTCTCGAGAATGCCTTGGTTGTTCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_355081.1-1795s1c1
Sequence:CCGGCCTGATGATTTCAAGGACTATCTCGAGATAGTCCTTGAAATCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355081.1-1002s1c1
Sequence:CCGGGCTGTCCAAGACCTACACTAACTCGAGTTAGTGTAGGTCTTGGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_355081.1-2125s1c1
Sequence:CCGGCGGTTGCAGCAAAGAGGATTTCTCGAGAAATCCTCTTTGCTGCAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355081.1-696s1c1
Sequence:CCGGCGGTCGCAAGTTCGTTTACTTCTCGAGAAGTAAACGAACTTGCGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001142731
VALIDATED
KCTD1 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000376226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001142731.1-2038s21c1
Sequence:CCGGAGTCTCAAACAGCACTATTTCCTCGAGGAAATAGTGCTGTTTGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142731.1-2777s21c1
Sequence:CCGGATGATATCCTCAAGATGTAAACTCGAGTTTACATCTTGAGGATATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001142731.1-2564s21c1
Sequence:CCGGTACCCTCAGTCATCCGGATAACTCGAGTTATCCGGATGACTGAGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142731.1-1050s21c1
Sequence:CCGGGTCGCTTGGGCCTTACCATAACTCGAGTTATGGTAAGGCCCAAGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001142731
VALIDATED
KCTD1 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000376226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001142731.1-2038s21c1
Sequence:CCGGAGTCTCAAACAGCACTATTTCCTCGAGGAAATAGTGCTGTTTGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142731.1-2777s21c1
Sequence:CCGGATGATATCCTCAAGATGTAAACTCGAGTTTACATCTTGAGGATATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001142731.1-2564s21c1
Sequence:CCGGTACCCTCAGTCATCCGGATAACTCGAGTTATCCGGATGACTGAGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142731.1-1050s21c1
Sequence:CCGGGTCGCTTGGGCCTTACCATAACTCGAGTTATGGTAAGGCCCAAGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001142731
VALIDATED
KCTD1 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000376226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001142731.1-2038s21c1
Sequence:CCGGAGTCTCAAACAGCACTATTTCCTCGAGGAAATAGTGCTGTTTGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001142731.1-2777s21c1
Sequence:CCGGATGATATCCTCAAGATGTAAACTCGAGTTTACATCTTGAGGATATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001142731.1-2564s21c1
Sequence:CCGGTACCCTCAGTCATCCGGATAACTCGAGTTATCCGGATGACTGAGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001142731.1-1050s21c1
Sequence:CCGGGTCGCTTGGGCCTTACCATAACTCGAGTTATGGTAAGGCCCAAGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)