EMAIL THIS PAGE TO A FRIEND

KCTD20

potassium channel tetramerization domain containing 20

70 Gene Product Result for
Synonyms: C6orf69 dJ108K11.3
UniProtKB ID: Q7Z5Y7, B4E2Q3, Q5W105, Q69YQ7, Q8IZ55
Gene ID:
Mouse(66989) potassium channel tetramerisation domain containing 20
Rat(294307) potassium channel tetramerization domain containing 20
chicken(419814) potassium channel tetramerisation domain containing 20
dog(474889) potassium channel tetramerisation domain containing 20
domestic cat(101080713) potassium channel tetramerisation domain containing 20
cow(514967) potassium channel tetramerisation domain containing 20
Horse(100053696) potassium channel tetramerisation domain containing 20
sheep(101120959) potassium channel tetramerisation domain containing 20
Domestic Rabbit(100345429) potassium channel tetramerisation domain containing 20
domestic guinea pig(100722740) potassium channel tetramerization domain containing 20
naked mole-rat(101712954) potassium channel tetramerisation domain containing 20
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173562 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173562 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173562 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025888 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025888 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025888 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173562 Rosetta Predictions human pricing
XM_001078592 Rosetta Predictions rat pricing
XM_228042 Rosetta Predictions rat pricing
NM_025888 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237246 predicted 733
2 SASI_Hs01_00237247 predicted 681
3 SASI_Hs01_00237248 predicted 1047
4 SASI_Hs02_00368387 predicted 1532
5 SASI_Hs01_00237249 predicted 983
6 SASI_Hs01_00237250 predicted 706
7 SASI_Hs02_00368388 predicted 1479
8 SASI_Hs01_00237252 predicted 1081
9 SASI_Hs02_00368389 predicted 1619
10 SASI_Hs01_00237255 predicted 1493
11 SASI_Hs01_00237251 predicted 1246
12 SASI_Hs01_00237253 predicted 1192
13 SASI_Hs01_00237254 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361378 predicted 1214
2 SASI_Rn02_00361379 predicted 1090
3 SASI_Rn02_00361380 predicted 1054
4 SASI_Rn02_00361381 predicted 875
5 SASI_Rn02_00361382 predicted 870
6 SASI_Rn02_00361383 predicted 458
7 SASI_Rn02_00361384 predicted 408
8 SASI_Rn02_00361385 predicted 592
9 SASI_Rn02_00361386 predicted 997
10 SASI_Rn02_00361387 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384861 predicted 1254
2 SASI_Rn02_00384862 predicted 1127
3 SASI_Rn02_00384863 predicted 1086
4 SASI_Rn02_00384864 predicted 911
5 SASI_Rn02_00384865 predicted 912
6 SASI_Rn02_00384866 predicted 499
7 SASI_Rn02_00384867 predicted 445
8 SASI_Rn02_00384868 predicted 1026
9 SASI_Rn02_00384869 predicted 471
10 SASI_Rn02_00384870 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098858 predicted 1294
2 SASI_Mm01_00098859 predicted 1041
3 SASI_Mm01_00098860 predicted 1382
4 SASI_Mm01_00098861 predicted 1256
5 SASI_Mm01_00098862 predicted 574
6 SASI_Mm01_00098863 predicted 894
7 SASI_Mm01_00098864 predicted 443
8 SASI_Mm01_00098865 predicted 294
9 SASI_Mm01_00098866 predicted 560
10 SASI_Mm01_00098867 predicted 1422
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173562
VALIDATED
KCTD20 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 20
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173562.3-737s1c1
Sequence:CCGGCCAGAGAAAGTGACGCTTCTTCTCGAGAAGAAGCGTCACTTTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_173562.3-1502s1c1
Sequence:CCGGCGAAGCAAATCCCTCACGAATCTCGAGATTCGTGAGGGATTTGCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173562.3-2735s1c1
Sequence:CCGGGCTCACACATTGGGTAGGAATCTCGAGATTCCTACCCAATGTGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173562.3-1589s21c1
Sequence:CCGGGATGAACTTGACCGGCTAAATCTCGAGATTTAGCCGGTCAAGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_173562.3-3774s1c1
Sequence:CCGGCCAGGTATGAAGTATGGCATACTCGAGTATGCCATACTTCATACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_173562.3-1628s1c1
Sequence:CCGGGCTTCTAACGACTTTCAGGATCTCGAGATCCTGAAAGTCGTTAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173562
VALIDATED
KCTD20 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 20
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173562.3-737s1c1
Sequence:CCGGCCAGAGAAAGTGACGCTTCTTCTCGAGAAGAAGCGTCACTTTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_173562.3-1502s1c1
Sequence:CCGGCGAAGCAAATCCCTCACGAATCTCGAGATTCGTGAGGGATTTGCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173562.3-2735s1c1
Sequence:CCGGGCTCACACATTGGGTAGGAATCTCGAGATTCCTACCCAATGTGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173562.3-1589s21c1
Sequence:CCGGGATGAACTTGACCGGCTAAATCTCGAGATTTAGCCGGTCAAGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_173562.3-3774s1c1
Sequence:CCGGCCAGGTATGAAGTATGGCATACTCGAGTATGCCATACTTCATACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_173562.3-1628s1c1
Sequence:CCGGGCTTCTAACGACTTTCAGGATCTCGAGATCCTGAAAGTCGTTAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173562
VALIDATED
KCTD20 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 20
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_173562.3-737s1c1
Sequence:CCGGCCAGAGAAAGTGACGCTTCTTCTCGAGAAGAAGCGTCACTTTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_173562.3-1502s1c1
Sequence:CCGGCGAAGCAAATCCCTCACGAATCTCGAGATTCGTGAGGGATTTGCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173562.3-2735s1c1
Sequence:CCGGGCTCACACATTGGGTAGGAATCTCGAGATTCCTACCCAATGTGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173562.3-1589s21c1
Sequence:CCGGGATGAACTTGACCGGCTAAATCTCGAGATTTAGCCGGTCAAGTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_173562.3-3774s1c1
Sequence:CCGGCCAGGTATGAAGTATGGCATACTCGAGTATGCCATACTTCATACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_173562.3-1628s1c1
Sequence:CCGGGCTTCTAACGACTTTCAGGATCTCGAGATCCTGAAAGTCGTTAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025888
VALIDATED
KCTD20 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 20
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025888.3-593s1c1
Sequence:CCGGGCCGGGAAGAGAATACAACTTCTCGAGAAGTTGTATTCTCTTCCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025888.3-2209s1c1
Sequence:CCGGCCTGACAGCAATGTCTGCAATCTCGAGATTGCAGACATTGCTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025888.5-1333s21c1
Sequence:CCGGCCACCACAAGTAGATGAACTTCTCGAGAAGTTCATCTACTTGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025888.3-1335s1c1
Sequence:CCGGCCACCACAAGTAGATGAACTTCTCGAGAAGTTCATCTACTTGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025888.5-2207s21c1
Sequence:CCGGCCTGACAGCAATGTCTGCAATCTCGAGATTGCAGACATTGCTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025888.5-749s21c1
Sequence:CCGGCGTGTGACTATCTCTGCATTACTCGAGTAATGCAGAGATAGTCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025888.3-751s1c1
Sequence:CCGGCGTGTGACTATCTCTGCATTACTCGAGTAATGCAGAGATAGTCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025888.3-1386s1c1
Sequence:CCGGGCTCCGAATGACTTTCAAGATCTCGAGATCTTGAAAGTCATTCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025888.5-1384s21c1
Sequence:CCGGGCTCCGAATGACTTTCAAGATCTCGAGATCTTGAAAGTCATTCGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025888
VALIDATED
KCTD20 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 20
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025888.3-593s1c1
Sequence:CCGGGCCGGGAAGAGAATACAACTTCTCGAGAAGTTGTATTCTCTTCCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025888.3-2209s1c1
Sequence:CCGGCCTGACAGCAATGTCTGCAATCTCGAGATTGCAGACATTGCTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025888.5-1333s21c1
Sequence:CCGGCCACCACAAGTAGATGAACTTCTCGAGAAGTTCATCTACTTGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025888.3-1335s1c1
Sequence:CCGGCCACCACAAGTAGATGAACTTCTCGAGAAGTTCATCTACTTGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025888.5-2207s21c1
Sequence:CCGGCCTGACAGCAATGTCTGCAATCTCGAGATTGCAGACATTGCTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025888.5-749s21c1
Sequence:CCGGCGTGTGACTATCTCTGCATTACTCGAGTAATGCAGAGATAGTCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025888.3-751s1c1
Sequence:CCGGCGTGTGACTATCTCTGCATTACTCGAGTAATGCAGAGATAGTCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025888.3-1386s1c1
Sequence:CCGGGCTCCGAATGACTTTCAAGATCTCGAGATCTTGAAAGTCATTCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025888.5-1384s21c1
Sequence:CCGGGCTCCGAATGACTTTCAAGATCTCGAGATCTTGAAAGTCATTCGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025888
VALIDATED
KCTD20 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 20
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025888.3-593s1c1
Sequence:CCGGGCCGGGAAGAGAATACAACTTCTCGAGAAGTTGTATTCTCTTCCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025888.3-2209s1c1
Sequence:CCGGCCTGACAGCAATGTCTGCAATCTCGAGATTGCAGACATTGCTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025888.5-1333s21c1
Sequence:CCGGCCACCACAAGTAGATGAACTTCTCGAGAAGTTCATCTACTTGTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025888.3-1335s1c1
Sequence:CCGGCCACCACAAGTAGATGAACTTCTCGAGAAGTTCATCTACTTGTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316895    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025888.5-2207s21c1
Sequence:CCGGCCTGACAGCAATGTCTGCAATCTCGAGATTGCAGACATTGCTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025888.5-749s21c1
Sequence:CCGGCGTGTGACTATCTCTGCATTACTCGAGTAATGCAGAGATAGTCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025888.3-751s1c1
Sequence:CCGGCGTGTGACTATCTCTGCATTACTCGAGTAATGCAGAGATAGTCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025888.3-1386s1c1
Sequence:CCGGGCTCCGAATGACTTTCAAGATCTCGAGATCTTGAAAGTCATTCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025888.5-1384s21c1
Sequence:CCGGGCTCCGAATGACTTTCAAGATCTCGAGATCTTGAAAGTCATTCGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)