EMAIL THIS PAGE TO A FRIEND

KCTD21

potassium channel tetramerization domain containing 21

122 Gene Product Result for
Synonyms: KCASH2
UniProtKB ID: Q4G0X4, B4DTR0
Gene ID:
Mouse(622320) potassium channel tetramerisation domain containing 21
Rat(499209) potassium channel tetramerization domain containing 21
domestic guinea pig(100735642) potassium channel tetramerization domain containing 21
naked mole-rat(101718563) potassium channel tetramerisation domain containing 21
Goat(100861131) potassium channel tetramerisation domain containing 21
sheep(101109401) potassium channel tetramerisation domain containing 21
chicken(428098) potassium channel tetramerisation domain containing 21
cow(539645) potassium channel tetramerisation domain containing 21
domestic cat(101101665) potassium channel tetramerisation domain containing 21
dog(608875) potassium channel tetramerisation domain containing 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV54466 Anti-KCTD21 antibody produced in rabbit affinity isolated antibody mouse, human, dog, rabbit, rat, bovine, guinea pig, horse
western blot pricing
SAB2105936 Anti-KCTD21 antibody produced in rabbit affinity isolated antibody bovine, dog, rabbit, goat, guinea pig, human, mouse, rat, horse
western blot pricing
HPA041964 Anti-KCTD21 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039039 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039039 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039039 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001029859 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029859 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029859 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047951 MISSION® esiRNA esiRNA human KCTD21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029859 Rosetta Predictions human pricing
NM_001109151 Rosetta Predictions rat pricing
NM_001039039 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014984 predicted 426
2 SASI_Hs01_00014985 predicted 226
3 SASI_Hs01_00014987 predicted 945
4 SASI_Hs02_00307534 predicted 1065
5 SASI_Hs01_00014988 predicted 549
6 SASI_Hs02_00307535 predicted 628
7 SASI_Hs01_00014989 predicted 1024
8 SASI_Hs01_00014990 predicted 777
9 SASI_Hs01_00014992 predicted 734
10 SASI_Hs01_00014993 predicted 1205
11 SASI_Hs01_00014986 predicted 830
12 SASI_Hs01_00014991 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109151 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245630 predicted 502
2 SASI_Rn02_00245631 predicted 449
3 SASI_Rn02_00245632 predicted 538
4 SASI_Rn02_00245633 predicted 526
5 SASI_Rn02_00245634 predicted 344
6 SASI_Rn02_00245635 predicted 472
7 SASI_Rn02_00245636 predicted 627
8 SASI_Rn02_00245637 predicted 418
9 SASI_Rn02_00245638 predicted 320
10 SASI_Rn02_00245639 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039039 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132950 predicted 945
2 SASI_Mm01_00132951 predicted 1274
3 SASI_Mm01_00132952 predicted 622
4 SASI_Mm01_00132953 predicted 840
5 SASI_Mm01_00132955 predicted 1014
6 SASI_Mm02_00289725 predicted 238
7 SASI_Mm01_00132956 predicted 772
8 SASI_Mm01_00132957 predicted 1095
9 SASI_Mm01_00132958 predicted 613
10 SASI_Mm01_00132959 predicted 1109
11 SASI_Mm01_00132954 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039039
KCTD21 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 21
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039039.3-234s21c1
Sequence:CCGGTGGCAAAGTGTTCCGCTATATCTCGAGATATAGCGGAACACTTTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039039.3-206s21c1
Sequence:CCGGGCCAGGGTAACTGCTTCATTGCTCGAGCAATGAAGCAGTTACCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039039.3-2656s21c1
Sequence:CCGGAGCAGATCTGTGGTCATATTCCTCGAGGAATATGACCACAGATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039039.3-397s21c1
Sequence:CCGGGAGAAGAATGCCATGCTTAACCTCGAGGTTAAGCATGGCATTCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039039.3-828s21c1
Sequence:CCGGCAATAAGATCATTCGGTTAATCTCGAGATTAACCGAATGATCTTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039039
KCTD21 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 21
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039039.3-234s21c1
Sequence:CCGGTGGCAAAGTGTTCCGCTATATCTCGAGATATAGCGGAACACTTTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039039.3-206s21c1
Sequence:CCGGGCCAGGGTAACTGCTTCATTGCTCGAGCAATGAAGCAGTTACCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039039.3-2656s21c1
Sequence:CCGGAGCAGATCTGTGGTCATATTCCTCGAGGAATATGACCACAGATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039039.3-397s21c1
Sequence:CCGGGAGAAGAATGCCATGCTTAACCTCGAGGTTAAGCATGGCATTCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039039.3-828s21c1
Sequence:CCGGCAATAAGATCATTCGGTTAATCTCGAGATTAACCGAATGATCTTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039039
KCTD21 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 21
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039039.3-234s21c1
Sequence:CCGGTGGCAAAGTGTTCCGCTATATCTCGAGATATAGCGGAACACTTTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039039.3-206s21c1
Sequence:CCGGGCCAGGGTAACTGCTTCATTGCTCGAGCAATGAAGCAGTTACCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039039.3-2656s21c1
Sequence:CCGGAGCAGATCTGTGGTCATATTCCTCGAGGAATATGACCACAGATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039039.3-397s21c1
Sequence:CCGGGAGAAGAATGCCATGCTTAACCTCGAGGTTAAGCATGGCATTCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039039.3-828s21c1
Sequence:CCGGCAATAAGATCATTCGGTTAATCTCGAGATTAACCGAATGATCTTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029859
VALIDATED
KCTD21 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 21
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029859.1-108s1c1
Sequence:CCGGGAAGCTCTATACAACCTCACTCTCGAGAGTGAGGTTGTATAGAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029859.1-790s1c1
Sequence:CCGGGATTCTTCTCACCCACATGCTCTCGAGAGCATGTGGGTGAGAAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029859.1-1578s1c1
Sequence:CCGGGCCAGTGTAATGAAATCACTTCTCGAGAAGTGATTTCATTACACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001029859.1-549s1c1
Sequence:CCGGCCTTGGCTCTAAGCTCTTCTACTCGAGTAGAAGAGCTTAGAGCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029859.1-576s1c1
Sequence:CCGGCAATGGCAATCTCTCCTCCATCTCGAGATGGAGGAGAGATTGCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029859.1-994s1c1
Sequence:CCGGCCCATGATGAAGTCCACCTTTCTCGAGAAAGGTGGACTTCATCATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029859.1-1077s1c1
Sequence:CCGGCGGTTTATTATGACAAGTGAACTCGAGTTCACTTGTCATAATAAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001029859.1-786s1c1
Sequence:CCGGCATCGATTCTTCTCACCCACACTCGAGTGTGGGTGAGAAGAATCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001029859.1-404s1c1
Sequence:CCGGCCATGCTCAACATCACACTGACTCGAGTCAGTGTGATGTTGAGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029859.1-210s1c1
Sequence:CCGGCAACTGCTTCATTGACCGTGACTCGAGTCACGGTCAATGAAGCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029859.1-393s1c1
Sequence:CCGGCGAGAAGAATGCCATGCTCAACTCGAGTTGAGCATGGCATTCTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029859.1-723s1c1
Sequence:CCGGGATCAACAGCTTCCAGGTCTTCTCGAGAAGACCTGGAAGCTGTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001029859.1-564s1c1
Sequence:CCGGCTTCTACTGCTCCAATGGCAACTCGAGTTGCCATTGGAGCAGTAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029859
VALIDATED
KCTD21 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 21
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029859.1-108s1c1
Sequence:CCGGGAAGCTCTATACAACCTCACTCTCGAGAGTGAGGTTGTATAGAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029859.1-790s1c1
Sequence:CCGGGATTCTTCTCACCCACATGCTCTCGAGAGCATGTGGGTGAGAAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029859.1-1578s1c1
Sequence:CCGGGCCAGTGTAATGAAATCACTTCTCGAGAAGTGATTTCATTACACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001029859.1-549s1c1
Sequence:CCGGCCTTGGCTCTAAGCTCTTCTACTCGAGTAGAAGAGCTTAGAGCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029859.1-576s1c1
Sequence:CCGGCAATGGCAATCTCTCCTCCATCTCGAGATGGAGGAGAGATTGCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029859.1-994s1c1
Sequence:CCGGCCCATGATGAAGTCCACCTTTCTCGAGAAAGGTGGACTTCATCATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029859.1-1077s1c1
Sequence:CCGGCGGTTTATTATGACAAGTGAACTCGAGTTCACTTGTCATAATAAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001029859.1-786s1c1
Sequence:CCGGCATCGATTCTTCTCACCCACACTCGAGTGTGGGTGAGAAGAATCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001029859.1-404s1c1
Sequence:CCGGCCATGCTCAACATCACACTGACTCGAGTCAGTGTGATGTTGAGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029859.1-210s1c1
Sequence:CCGGCAACTGCTTCATTGACCGTGACTCGAGTCACGGTCAATGAAGCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029859.1-393s1c1
Sequence:CCGGCGAGAAGAATGCCATGCTCAACTCGAGTTGAGCATGGCATTCTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029859.1-723s1c1
Sequence:CCGGGATCAACAGCTTCCAGGTCTTCTCGAGAAGACCTGGAAGCTGTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001029859.1-564s1c1
Sequence:CCGGCTTCTACTGCTCCAATGGCAACTCGAGTTGCCATTGGAGCAGTAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029859
VALIDATED
KCTD21 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 21
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029859.1-108s1c1
Sequence:CCGGGAAGCTCTATACAACCTCACTCTCGAGAGTGAGGTTGTATAGAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029859.1-790s1c1
Sequence:CCGGGATTCTTCTCACCCACATGCTCTCGAGAGCATGTGGGTGAGAAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145150    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029859.1-1578s1c1
Sequence:CCGGGCCAGTGTAATGAAATCACTTCTCGAGAAGTGATTTCATTACACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001029859.1-549s1c1
Sequence:CCGGCCTTGGCTCTAAGCTCTTCTACTCGAGTAGAAGAGCTTAGAGCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029859.1-576s1c1
Sequence:CCGGCAATGGCAATCTCTCCTCCATCTCGAGATGGAGGAGAGATTGCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139364    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029859.1-994s1c1
Sequence:CCGGCCCATGATGAAGTCCACCTTTCTCGAGAAAGGTGGACTTCATCATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029859.1-1077s1c1
Sequence:CCGGCGGTTTATTATGACAAGTGAACTCGAGTTCACTTGTCATAATAAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001029859.1-786s1c1
Sequence:CCGGCATCGATTCTTCTCACCCACACTCGAGTGTGGGTGAGAAGAATCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001029859.1-404s1c1
Sequence:CCGGCCATGCTCAACATCACACTGACTCGAGTCAGTGTGATGTTGAGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029859.1-210s1c1
Sequence:CCGGCAACTGCTTCATTGACCGTGACTCGAGTCACGGTCAATGAAGCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029859.1-393s1c1
Sequence:CCGGCGAGAAGAATGCCATGCTCAACTCGAGTTGAGCATGGCATTCTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029859.1-723s1c1
Sequence:CCGGGATCAACAGCTTCCAGGTCTTCTCGAGAAGACCTGGAAGCTGTTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001029859.1-564s1c1
Sequence:CCGGCTTCTACTGCTCCAATGGCAACTCGAGTTGCCATTGGAGCAGTAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)