EMAIL THIS PAGE TO A FRIEND

KCTD2

potassium channel tetramerization domain containing 2

183 Gene Product Result for
UniProtKB ID: Q14681
Gene ID:
Mouse(70382) potassium channel tetramerisation domain containing 2
Rat(498024) potassium channel tetramerization domain containing 2
domestic guinea pig(100724818) potassium channel tetramerization domain containing 2
naked mole-rat(101705842) potassium channel tetramerisation domain containing 2
sheep(101122963) potassium channel tetramerisation domain containing 2
Zebrafish(751724) potassium channel tetramerisation domain containing 2
cow(789539) potassium channel tetramerization domain containing 2
domestic cat(101093221) potassium channel tetramerisation domain containing 2
dog(609652) potassium channel tetramerisation domain containing 2
chicken(422116) potassium channel tetramerisation domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302507 ANTI-KCTD2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183285 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183285 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183285 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015353 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015353 Rosetta Predictions human pricing
XM_001081684 Rosetta Predictions rat pricing
XM_573223 Rosetta Predictions rat pricing
NM_183285 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114726 predicted 788
2 SASI_Hs01_00114727 predicted 725
3 SASI_Hs01_00114728 predicted 542
4 SASI_Hs01_00114729 predicted 838
5 SASI_Hs01_00114730 predicted 1097
6 SASI_Hs01_00114731 predicted 979
7 SASI_Hs01_00114732 predicted 560
8 SASI_Hs01_00114733 predicted 697
9 SASI_Hs01_00114734 predicted 795
10 SASI_Hs02_00347678 predicted 680
11 SASI_Hs01_00114735 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372981 predicted 580
2 SASI_Rn02_00372982 predicted 317
3 SASI_Rn02_00372983 predicted 397
4 SASI_Rn02_00372984 predicted 437
5 SASI_Rn02_00372985 predicted 403
6 SASI_Rn02_00372986 predicted 346
7 SASI_Rn02_00372987 predicted 319
8 SASI_Rn02_00372988 predicted 522
9 SASI_Rn02_00372989 predicted 966
10 SASI_Rn02_00372990 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400034 predicted 226
2 SASI_Rn02_00400035 predicted 363
3 SASI_Rn02_00400036 predicted 416
4 SASI_Rn02_00400037 predicted 479
5 SASI_Rn02_00400038 predicted 465
6 SASI_Rn02_00400039 predicted 379
7 SASI_Rn02_00400040 predicted 334
8 SASI_Rn02_00400041 predicted 354
9 SASI_Rn02_00400042 predicted 358
10 SASI_Rn02_00400043 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183285 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129168 predicted 734
2 SASI_Mm01_00129169 predicted 696
3 SASI_Mm01_00129170 predicted 651
4 SASI_Mm01_00129171 predicted 700
5 SASI_Mm01_00129172 predicted 753
6 SASI_Mm01_00129173 predicted 752
7 SASI_Mm01_00129174 predicted 391
8 SASI_Mm01_00129175 predicted 531
9 SASI_Mm01_00129176 predicted 426
10 SASI_Mm01_00129177 predicted 394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183285
VALIDATED
KCTD2 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183285.2-739s21c1
Sequence:CCGGTCTACCAATGGCATCGTCATACTCGAGTATGACGATGCCATTGGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183285.2-425s21c1
Sequence:CCGGGCCATGGGAAACTCATCATTACTCGAGTAATGATGAGTTTCCCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183285.2-877s21c1
Sequence:CCGGATCCTGCACCTGTACAGTAACCTCGAGGTTACTGTACAGGTGCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183285.1-690s1c1
Sequence:CCGGCTCTTCCTATAACTATGGAAACTCGAGTTTCCATAGTTATAGGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183285.2-511s21c1
Sequence:CCGGCGGCTGGTTAAGGAAAGGATACTCGAGTATCCTTTCCTTAACCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183285.2-395s21c1
Sequence:CCGGCCTACTTTGGTCCTATCCTAACTCGAGTTAGGATAGGACCAAAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183285.1-659s1c1
Sequence:CCGGGCTGGAAATTTGAACAGTTAACTCGAGTTAACTGTTCAAATTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183285.1-532s1c1
Sequence:CCGGCGGCTGGTTAAGGAAAGGATACTCGAGTATCCTTTCCTTAACCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183285.1-760s1c1
Sequence:CCGGTCTACCAATGGCATCGTCATACTCGAGTATGACGATGCCATTGGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183285.1-416s1c1
Sequence:CCGGCCTACTTTGGTCCTATCCTAACTCGAGTTAGGATAGGACCAAAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183285
VALIDATED
KCTD2 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183285.2-739s21c1
Sequence:CCGGTCTACCAATGGCATCGTCATACTCGAGTATGACGATGCCATTGGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183285.2-425s21c1
Sequence:CCGGGCCATGGGAAACTCATCATTACTCGAGTAATGATGAGTTTCCCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183285.2-877s21c1
Sequence:CCGGATCCTGCACCTGTACAGTAACCTCGAGGTTACTGTACAGGTGCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183285.1-690s1c1
Sequence:CCGGCTCTTCCTATAACTATGGAAACTCGAGTTTCCATAGTTATAGGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183285.2-511s21c1
Sequence:CCGGCGGCTGGTTAAGGAAAGGATACTCGAGTATCCTTTCCTTAACCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183285.2-395s21c1
Sequence:CCGGCCTACTTTGGTCCTATCCTAACTCGAGTTAGGATAGGACCAAAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183285.1-659s1c1
Sequence:CCGGGCTGGAAATTTGAACAGTTAACTCGAGTTAACTGTTCAAATTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183285.1-532s1c1
Sequence:CCGGCGGCTGGTTAAGGAAAGGATACTCGAGTATCCTTTCCTTAACCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183285.1-760s1c1
Sequence:CCGGTCTACCAATGGCATCGTCATACTCGAGTATGACGATGCCATTGGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183285.1-416s1c1
Sequence:CCGGCCTACTTTGGTCCTATCCTAACTCGAGTTAGGATAGGACCAAAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183285
VALIDATED
KCTD2 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183285.2-739s21c1
Sequence:CCGGTCTACCAATGGCATCGTCATACTCGAGTATGACGATGCCATTGGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183285.2-425s21c1
Sequence:CCGGGCCATGGGAAACTCATCATTACTCGAGTAATGATGAGTTTCCCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319448    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183285.2-877s21c1
Sequence:CCGGATCCTGCACCTGTACAGTAACCTCGAGGTTACTGTACAGGTGCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183285.1-690s1c1
Sequence:CCGGCTCTTCCTATAACTATGGAAACTCGAGTTTCCATAGTTATAGGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183285.2-511s21c1
Sequence:CCGGCGGCTGGTTAAGGAAAGGATACTCGAGTATCCTTTCCTTAACCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_183285.2-395s21c1
Sequence:CCGGCCTACTTTGGTCCTATCCTAACTCGAGTTAGGATAGGACCAAAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183285.1-659s1c1
Sequence:CCGGGCTGGAAATTTGAACAGTTAACTCGAGTTAACTGTTCAAATTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183285.1-532s1c1
Sequence:CCGGCGGCTGGTTAAGGAAAGGATACTCGAGTATCCTTTCCTTAACCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183285.1-760s1c1
Sequence:CCGGTCTACCAATGGCATCGTCATACTCGAGTATGACGATGCCATTGGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183285.1-416s1c1
Sequence:CCGGCCTACTTTGGTCCTATCCTAACTCGAGTTAGGATAGGACCAAAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015353
KCTD2 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015353.1-444s1c1
Sequence:CCGGCCTACTTTGGTCCTATCCTCACTCGAGTGAGGATAGGACCAAAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015353.1-687s1c1
Sequence:CCGGGCTGGAAATTCGAACAGCTCACTCGAGTGAGCTGTTCGAATTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015353.1-2142s1c1
Sequence:CCGGCCGAATAACTTTCAGTAGTATCTCGAGATACTACTGAAAGTTATTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015353.1-2141s1c1
Sequence:CCGGCCCGAATAACTTTCAGTAGTACTCGAGTACTACTGAAAGTTATTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015353.1-1834s1c1
Sequence:CCGGGCCTTGACTGAATGTGCAATACTCGAGTATTGCACATTCAGTCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015353.1-2903s1c1
Sequence:CCGGGCCGTTTCCTTCATTCCTCTTCTCGAGAAGAGGAATGAAGGAAACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015353.1-560s1c1
Sequence:CCGGCGGCTGGTTAAGGAAAGGATACTCGAGTATCCTTTCCTTAACCAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015353.1-581s1c1
Sequence:CCGGCGGGACAATGAGAACAGAACTCTCGAGAGTTCTGTTCTCATTGTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015353
KCTD2 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015353.1-444s1c1
Sequence:CCGGCCTACTTTGGTCCTATCCTCACTCGAGTGAGGATAGGACCAAAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015353.1-687s1c1
Sequence:CCGGGCTGGAAATTCGAACAGCTCACTCGAGTGAGCTGTTCGAATTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015353.1-2142s1c1
Sequence:CCGGCCGAATAACTTTCAGTAGTATCTCGAGATACTACTGAAAGTTATTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015353.1-2141s1c1
Sequence:CCGGCCCGAATAACTTTCAGTAGTACTCGAGTACTACTGAAAGTTATTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015353.1-1834s1c1
Sequence:CCGGGCCTTGACTGAATGTGCAATACTCGAGTATTGCACATTCAGTCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015353.1-2903s1c1
Sequence:CCGGGCCGTTTCCTTCATTCCTCTTCTCGAGAAGAGGAATGAAGGAAACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015353.1-560s1c1
Sequence:CCGGCGGCTGGTTAAGGAAAGGATACTCGAGTATCCTTTCCTTAACCAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015353.1-581s1c1
Sequence:CCGGCGGGACAATGAGAACAGAACTCTCGAGAGTTCTGTTCTCATTGTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015353
KCTD2 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015353.1-444s1c1
Sequence:CCGGCCTACTTTGGTCCTATCCTCACTCGAGTGAGGATAGGACCAAAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015353.1-687s1c1
Sequence:CCGGGCTGGAAATTCGAACAGCTCACTCGAGTGAGCTGTTCGAATTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015353.1-2142s1c1
Sequence:CCGGCCGAATAACTTTCAGTAGTATCTCGAGATACTACTGAAAGTTATTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015353.1-2141s1c1
Sequence:CCGGCCCGAATAACTTTCAGTAGTACTCGAGTACTACTGAAAGTTATTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015353.1-1834s1c1
Sequence:CCGGGCCTTGACTGAATGTGCAATACTCGAGTATTGCACATTCAGTCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015353.1-2903s1c1
Sequence:CCGGGCCGTTTCCTTCATTCCTCTTCTCGAGAAGAGGAATGAAGGAAACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015353.1-560s1c1
Sequence:CCGGCGGCTGGTTAAGGAAAGGATACTCGAGTATCCTTTCCTTAACCAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015353.1-581s1c1
Sequence:CCGGCGGGACAATGAGAACAGAACTCTCGAGAGTTCTGTTCTCATTGTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)