EMAIL THIS PAGE TO A FRIEND

KCTD3

potassium channel tetramerization domain containing 3

67 Gene Product Result for
Synonyms: NY-REN-45
Gene ID:
Mouse(226823) potassium channel tetramerisation domain containing 3
Rat(305055) potassium channel tetramerization domain containing 3
Zebrafish(569113) potassium channel tetramerisation domain containing 3
cow(505221) potassium channel tetramerization domain containing 3
domestic cat(101093830) potassium channel tetramerisation domain containing 3
dog(478960) potassium channel tetramerisation domain containing 3
chicken(421359) potassium channel tetramerisation domain containing 3
sheep(101120594) potassium channel tetramerisation domain containing 3
domestic guinea pig(100719894) potassium channel tetramerization domain containing 3
naked mole-rat(101705378) potassium channel tetramerisation domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016121 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016121 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016121 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172650 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172650 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172650 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016121 Rosetta Predictions human pricing
NM_001107199 Rosetta Predictions rat pricing
NM_172650 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231942 predicted 1638
2 SASI_Hs01_00231943 predicted 1666
3 SASI_Hs01_00231944 predicted 1871
4 SASI_Hs01_00231945 predicted 1909
5 SASI_Hs02_00348893 predicted 2211
6 SASI_Hs01_00231947 predicted 837
7 SASI_Hs01_00231948 predicted 945
8 SASI_Hs01_00231949 predicted 2110
9 SASI_Hs01_00231951 predicted 626
10 SASI_Hs02_00348894 predicted 2245
11 SASI_Hs01_00231946 predicted 1336
12 SASI_Hs01_00231950 predicted 2315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226485 predicted 819
2 SASI_Rn02_00226486 predicted 760
3 SASI_Rn02_00226487 predicted 1598
4 SASI_Rn02_00226488 predicted 1651
5 SASI_Rn02_00226489 predicted 1014
6 SASI_Rn02_00226490 predicted 1597
7 SASI_Rn02_00226491 predicted 2120
8 SASI_Rn02_00226492 predicted 2455
9 SASI_Rn02_00226493 predicted 814
10 SASI_Rn02_00226494 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193970 predicted 2475
2 SASI_Mm01_00193971 predicted 826
3 SASI_Mm01_00193972 predicted 1572
4 SASI_Mm01_00193973 predicted 1618
5 SASI_Mm01_00193974 predicted 485
6 SASI_Mm01_00193975 predicted 1670
7 SASI_Mm01_00193976 predicted 1707
8 SASI_Mm01_00193977 predicted 1613
9 SASI_Mm01_00193978 predicted 780
10 SASI_Mm01_00193979 predicted 1715
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016121
VALIDATED
KCTD3 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016121.3-1895s1c1
Sequence:CCGGCCTCATTTACAGTGAGGGAATCTCGAGATTCCCTCACTGTAAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016121.3-1774s1c1
Sequence:CCGGCGAGACGATCAACAGGTGTTTCTCGAGAAACACCTGTTGATCGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016121.3-844s1c1
Sequence:CCGGCCACGAAAGGTGCTAATAGTACTCGAGTACTATTAGCACCTTTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016121.3-2156s1c1
Sequence:CCGGGCCACTTACGAGAATCAAATTCTCGAGAATTTGATTCTCGTAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016121.3-959s1c1
Sequence:CCGGGCCCATATTTGGATTGGACTACTCGAGTAGTCCAATCCAAATATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016121.3-2298s21c1
Sequence:CCGGTAGGGACTTCCAGACTATTAACTCGAGTTAATAGTCTGGAAGTCCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016121.3-1286s21c1
Sequence:CCGGGATGTAACAATGGATCAATATCTCGAGATATTGATCCATTGTTACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016121
VALIDATED
KCTD3 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016121.3-1895s1c1
Sequence:CCGGCCTCATTTACAGTGAGGGAATCTCGAGATTCCCTCACTGTAAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016121.3-1774s1c1
Sequence:CCGGCGAGACGATCAACAGGTGTTTCTCGAGAAACACCTGTTGATCGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016121.3-844s1c1
Sequence:CCGGCCACGAAAGGTGCTAATAGTACTCGAGTACTATTAGCACCTTTCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016121.3-2156s1c1
Sequence:CCGGGCCACTTACGAGAATCAAATTCTCGAGAATTTGATTCTCGTAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016121.3-959s1c1
Sequence:CCGGGCCCATATTTGGATTGGACTACTCGAGTAGTCCAATCCAAATATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016121.3-2298s21c1
Sequence:CCGGTAGGGACTTCCAGACTATTAACTCGAGTTAATAGTCTGGAAGTCCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016121.3-1286s21c1
Sequence:CCGGGATGTAACAATGGATCAATATCTCGAGATATTGATCCATTGTTACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016121
VALIDATED
KCTD3 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016121.3-1895s1c1
Sequence:CCGGCCTCATTTACAGTGAGGGAATCTCGAGATTCCCTCACTGTAAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016121.3-1774s1c1
Sequence:CCGGCGAGACGATCAACAGGTGTTTCTCGAGAAACACCTGTTGATCGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016121.3-844s1c1
Sequence:CCGGCCACGAAAGGTGCTAATAGTACTCGAGTACTATTAGCACCTTTCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016121.3-2156s1c1
Sequence:CCGGGCCACTTACGAGAATCAAATTCTCGAGAATTTGATTCTCGTAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016121.3-959s1c1
Sequence:CCGGGCCCATATTTGGATTGGACTACTCGAGTAGTCCAATCCAAATATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016121.3-2298s21c1
Sequence:CCGGTAGGGACTTCCAGACTATTAACTCGAGTTAATAGTCTGGAAGTCCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016121.3-1286s21c1
Sequence:CCGGGATGTAACAATGGATCAATATCTCGAGATATTGATCCATTGTTACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172650
KCTD3 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172650.2-3070s1c1
Sequence:CCGGCCCTTATGATTGTGGAGTGTTCTCGAGAACACTCCACAATCATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172650.2-394s1c1
Sequence:CCGGCGAGATGAAACTGGTGCTATACTCGAGTATAGCACCAGTTTCATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172650.2-843s1c1
Sequence:CCGGCGCTGTGTGTTACAGAATCAACTCGAGTTGATTCTGTAACACACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172650.2-1578s1c1
Sequence:CCGGGACACGATTCAGAGGGATGATCTCGAGATCATCCCTCTGAATCGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172650.2-882s1c1
Sequence:CCGGGCAGGTGTTTACAAGCCCTTACTCGAGTAAGGGCTTGTAAACACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172650.2-1166s21c1
Sequence:CCGGTGCAGGACGTTGTCCCAATAACTCGAGTTATTGGGACAACGTCCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172650.2-333s21c1
Sequence:CCGGGCTCATGTGGATTCCAGATTCCTCGAGGAATCTGGAATCCACATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172650.2-505s21c1
Sequence:CCGGCTCAGGCACGAGGCAGAATTTCTCGAGAAATTCTGCCTCGTGCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172650.2-779s21c1
Sequence:CCGGATCCAAGAAAGGTGCTAATAGCTCGAGCTATTAGCACCTTTCTTGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172650.2-622s21c1
Sequence:CCGGCCAGGCATTCCCAGTCGTAAACTCGAGTTTACGACTGGGAATGCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172650
KCTD3 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172650.2-3070s1c1
Sequence:CCGGCCCTTATGATTGTGGAGTGTTCTCGAGAACACTCCACAATCATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172650.2-394s1c1
Sequence:CCGGCGAGATGAAACTGGTGCTATACTCGAGTATAGCACCAGTTTCATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172650.2-843s1c1
Sequence:CCGGCGCTGTGTGTTACAGAATCAACTCGAGTTGATTCTGTAACACACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172650.2-1578s1c1
Sequence:CCGGGACACGATTCAGAGGGATGATCTCGAGATCATCCCTCTGAATCGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172650.2-882s1c1
Sequence:CCGGGCAGGTGTTTACAAGCCCTTACTCGAGTAAGGGCTTGTAAACACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172650.2-1166s21c1
Sequence:CCGGTGCAGGACGTTGTCCCAATAACTCGAGTTATTGGGACAACGTCCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172650.2-333s21c1
Sequence:CCGGGCTCATGTGGATTCCAGATTCCTCGAGGAATCTGGAATCCACATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172650.2-505s21c1
Sequence:CCGGCTCAGGCACGAGGCAGAATTTCTCGAGAAATTCTGCCTCGTGCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172650.2-779s21c1
Sequence:CCGGATCCAAGAAAGGTGCTAATAGCTCGAGCTATTAGCACCTTTCTTGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172650.2-622s21c1
Sequence:CCGGCCAGGCATTCCCAGTCGTAAACTCGAGTTTACGACTGGGAATGCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172650
KCTD3 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172650.2-3070s1c1
Sequence:CCGGCCCTTATGATTGTGGAGTGTTCTCGAGAACACTCCACAATCATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172650.2-394s1c1
Sequence:CCGGCGAGATGAAACTGGTGCTATACTCGAGTATAGCACCAGTTTCATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172650.2-843s1c1
Sequence:CCGGCGCTGTGTGTTACAGAATCAACTCGAGTTGATTCTGTAACACACAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172650.2-1578s1c1
Sequence:CCGGGACACGATTCAGAGGGATGATCTCGAGATCATCCCTCTGAATCGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172650.2-882s1c1
Sequence:CCGGGCAGGTGTTTACAAGCCCTTACTCGAGTAAGGGCTTGTAAACACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172650.2-1166s21c1
Sequence:CCGGTGCAGGACGTTGTCCCAATAACTCGAGTTATTGGGACAACGTCCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172650.2-333s21c1
Sequence:CCGGGCTCATGTGGATTCCAGATTCCTCGAGGAATCTGGAATCCACATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172650.2-505s21c1
Sequence:CCGGCTCAGGCACGAGGCAGAATTTCTCGAGAAATTCTGCCTCGTGCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172650.2-779s21c1
Sequence:CCGGATCCAAGAAAGGTGCTAATAGCTCGAGCTATTAGCACCTTTCTTGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172650.2-622s21c1
Sequence:CCGGCCAGGCATTCCCAGTCGTAAACTCGAGTTTACGACTGGGAATGCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)