EMAIL THIS PAGE TO A FRIEND

KCTD4

potassium channel tetramerization domain containing 4

107 Gene Product Result for
Synonyms: bA321C24.3
UniProtKB ID: Q8WVF5, Q5W0P9
Gene ID:
Mouse(67516) potassium channel tetramerisation domain containing 4
Rat(691835) potassium channel tetramerization domain containing 4
domestic guinea pig(100715638) potassium channel tetramerization domain containing 4
naked mole-rat(101716120) potassium channel tetramerisation domain containing 4
sheep(101111108) potassium channel tetramerisation domain containing 4
Zebrafish(792402) potassium channel tetramerisation domain containing 4
cow(539536) potassium channel tetramerisation domain containing 4
domestic cat(101084080) potassium channel tetramerisation domain containing 4
dog(485456) potassium channel tetramerisation domain containing 4
chicken(769400) potassium channel tetramerisation domain containing 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198404 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026214 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026214 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026214 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198404 Rosetta Predictions human pricing
NM_001109650 Rosetta Predictions rat pricing
NM_026214 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158903 predicted 603
2 SASI_Hs01_00158904 predicted 804
3 SASI_Hs02_00371934 predicted 969
4 SASI_Hs01_00158905 predicted 814
5 SASI_Hs01_00158907 predicted 1126
6 SASI_Hs01_00158908 predicted 1076
7 SASI_Hs01_00158910 predicted 857
8 SASI_Hs02_00371935 predicted 437
9 SASI_Hs01_00158911 predicted 872
10 SASI_Hs02_00371936 predicted 848
11 SASI_Hs01_00158906 predicted 721
12 SASI_Hs01_00158909 predicted 273
13 SASI_Hs01_00158912 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109650 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250432 predicted 745
2 SASI_Rn02_00250433 predicted 558
3 SASI_Rn02_00250434 predicted 694
4 SASI_Rn02_00250435 predicted 602
5 SASI_Rn02_00250436 predicted 436
6 SASI_Rn02_00250437 predicted 822
7 SASI_Rn02_00250438 predicted 964
8 SASI_Rn02_00250439 predicted 740
9 SASI_Rn02_00250440 predicted 391
10 SASI_Rn02_00250441 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071078 predicted 894
2 SASI_Mm01_00071079 predicted 1036
3 SASI_Mm01_00071080 predicted 956
4 SASI_Mm02_00329882 predicted 803
5 SASI_Mm01_00071083 predicted 858
6 SASI_Mm01_00071084 predicted 799
7 SASI_Mm01_00071086 predicted 935
8 SASI_Mm02_00329883 predicted 1161
9 SASI_Mm02_00329884 predicted 1164
10 SASI_Mm02_00329885 predicted 793
11 SASI_Mm01_00071081 predicted 549
12 SASI_Mm01_00071082 predicted 1178
13 SASI_Mm01_00071085 predicted 679
14 SASI_Mm01_00071087 predicted 1124
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198404
KCTD4 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198404.2-571s21c1
Sequence:CCGGACACTTTCCTTGAAGGTATAGCTCGAGCTATACCTTCAAGGAAAGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198404.2-1652s21c1
Sequence:CCGGAGATGTGCAGATCTAACTAAACTCGAGTTTAGTTAGATCTGCACATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198404.2-1131s21c1
Sequence:CCGGGATTGTTCCAAAGGGTCAATTCTCGAGAATTGACCCTTTGGAACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198404.1-719s1c1
Sequence:CCGGCGTCAAATATCATCCGATTTACTCGAGTAAATCGGATGATATTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198404.1-661s1c1
Sequence:CCGGCGCATTGTTCTGGTGTCCAAACTCGAGTTTGGACACCAGAACAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198404.1-257s1c1
Sequence:CCGGCCCTCAACGTTGGTGGATATTCTCGAGAATATCCACCAACGTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198404.1-415s1c1
Sequence:CCGGGTCCTAAACTTCCTACGAAATCTCGAGATTTCGTAGGAAGTTTAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198404.1-794s1c1
Sequence:CCGGCCTTTGTCTGTACCTTGGAAACTCGAGTTTCCAAGGTACAGACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198404
KCTD4 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198404.2-571s21c1
Sequence:CCGGACACTTTCCTTGAAGGTATAGCTCGAGCTATACCTTCAAGGAAAGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198404.2-1652s21c1
Sequence:CCGGAGATGTGCAGATCTAACTAAACTCGAGTTTAGTTAGATCTGCACATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198404.2-1131s21c1
Sequence:CCGGGATTGTTCCAAAGGGTCAATTCTCGAGAATTGACCCTTTGGAACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198404.1-719s1c1
Sequence:CCGGCGTCAAATATCATCCGATTTACTCGAGTAAATCGGATGATATTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198404.1-661s1c1
Sequence:CCGGCGCATTGTTCTGGTGTCCAAACTCGAGTTTGGACACCAGAACAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198404.1-257s1c1
Sequence:CCGGCCCTCAACGTTGGTGGATATTCTCGAGAATATCCACCAACGTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198404.1-415s1c1
Sequence:CCGGGTCCTAAACTTCCTACGAAATCTCGAGATTTCGTAGGAAGTTTAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198404.1-794s1c1
Sequence:CCGGCCTTTGTCTGTACCTTGGAAACTCGAGTTTCCAAGGTACAGACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198404
KCTD4 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198404.2-571s21c1
Sequence:CCGGACACTTTCCTTGAAGGTATAGCTCGAGCTATACCTTCAAGGAAAGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198404.2-1652s21c1
Sequence:CCGGAGATGTGCAGATCTAACTAAACTCGAGTTTAGTTAGATCTGCACATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198404.2-1131s21c1
Sequence:CCGGGATTGTTCCAAAGGGTCAATTCTCGAGAATTGACCCTTTGGAACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198404.1-719s1c1
Sequence:CCGGCGTCAAATATCATCCGATTTACTCGAGTAAATCGGATGATATTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198404.1-661s1c1
Sequence:CCGGCGCATTGTTCTGGTGTCCAAACTCGAGTTTGGACACCAGAACAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198404.1-257s1c1
Sequence:CCGGCCCTCAACGTTGGTGGATATTCTCGAGAATATCCACCAACGTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198404.1-415s1c1
Sequence:CCGGGTCCTAAACTTCCTACGAAATCTCGAGATTTCGTAGGAAGTTTAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198404.1-794s1c1
Sequence:CCGGCCTTTGTCTGTACCTTGGAAACTCGAGTTTCCAAGGTACAGACAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026214
KCTD4 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026214.2-796s1c1
Sequence:CCGGGTGGGTTTAGACTGCTGACTACTCGAGTAGTCAGCAGTCTAAACCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026214.2-606s1c1
Sequence:CCGGCGCATTGTTCTGGTATCCAAACTCGAGTTTGGATACCAGAACAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026214.2-723s1c1
Sequence:CCGGCTAAAGGAAGACAACACCTTTCTCGAGAAAGGTGTTGTCTTCCTTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026214.2-510s1c1
Sequence:CCGGGAGACTACTTTCTTGGAAATACTCGAGTATTTCCAAGAAAGTAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026214.2-265s1c1
Sequence:CCGGCTTTCCTTGATGGTATCGTAACTCGAGTTACGATACCATCAAGGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026214
KCTD4 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026214.2-796s1c1
Sequence:CCGGGTGGGTTTAGACTGCTGACTACTCGAGTAGTCAGCAGTCTAAACCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026214.2-606s1c1
Sequence:CCGGCGCATTGTTCTGGTATCCAAACTCGAGTTTGGATACCAGAACAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026214.2-723s1c1
Sequence:CCGGCTAAAGGAAGACAACACCTTTCTCGAGAAAGGTGTTGTCTTCCTTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026214.2-510s1c1
Sequence:CCGGGAGACTACTTTCTTGGAAATACTCGAGTATTTCCAAGAAAGTAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026214.2-265s1c1
Sequence:CCGGCTTTCCTTGATGGTATCGTAACTCGAGTTACGATACCATCAAGGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026214
KCTD4 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026214.2-796s1c1
Sequence:CCGGGTGGGTTTAGACTGCTGACTACTCGAGTAGTCAGCAGTCTAAACCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026214.2-606s1c1
Sequence:CCGGCGCATTGTTCTGGTATCCAAACTCGAGTTTGGATACCAGAACAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026214.2-723s1c1
Sequence:CCGGCTAAAGGAAGACAACACCTTTCTCGAGAAAGGTGTTGTCTTCCTTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026214.2-510s1c1
Sequence:CCGGGAGACTACTTTCTTGGAAATACTCGAGTATTTCCAAGAAAGTAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026214.2-265s1c1
Sequence:CCGGCTTTCCTTGATGGTATCGTAACTCGAGTTACGATACCATCAAGGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)