EMAIL THIS PAGE TO A FRIEND

KCTD5

potassium channel tetramerization domain containing 5

109 Gene Product Result for
UniProtKB ID: Q9NXV2, D3DU96
Gene ID:
Mouse(69259) potassium channel tetramerisation domain containing 5
Rat(287109) potassium channel tetramerization domain containing 5
Zebrafish(322008) potassium channel tetramerisation domain containing 5
chicken(416589) potassium channel tetramerisation domain containing 5
cow(100125308) potassium channel tetramerisation domain containing 5
domestic cat(101101435) potassium channel tetramerisation domain containing 5
dog(490058) potassium channel tetramerisation domain containing 5
sheep(101116367) potassium channel tetramerisation domain containing 5
domestic guinea pig(100735697) potassium channel tetramerization domain containing 5
naked mole-rat(101710662) potassium channel tetramerisation domain containing 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1101633 Anti-KCTD5 (136-147) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018992 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018992 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018992 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027008 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027008 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027008 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004461 MISSION® esiRNA esiRNA targeting human KCTD5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018992 Rosetta Predictions human pricing
NM_001105768 Rosetta Predictions rat pricing
NM_027008 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043980 predicted 1081
2 SASI_Hs01_00043982 predicted 1087
3 SASI_Hs01_00043983 predicted 1047
4 SASI_Hs01_00043984 predicted 833
5 SASI_Hs01_00043985 predicted 578
6 SASI_Hs01_00043987 predicted 1082
7 SASI_Hs01_00043988 predicted 820
8 SASI_Hs02_00352495 predicted 410
9 SASI_Hs01_00043979 predicted 773
10 SASI_Hs02_00352496 predicted 733
11 SASI_Hs01_00043981 predicted 826
12 SASI_Hs01_00043986 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212336 predicted 334
2 SASI_Rn02_00212337 predicted 611
3 SASI_Rn02_00212338 predicted 1160
4 SASI_Rn02_00212339 predicted 571
5 SASI_Rn02_00212340 predicted 516
6 SASI_Rn02_00212341 predicted 268
7 SASI_Rn02_00212342 predicted 325
8 SASI_Rn02_00212343 predicted 299
9 SASI_Rn02_00212344 predicted 279
10 SASI_Rn02_00212345 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027008 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039425 predicted 255
2 SASI_Mm01_00039426 predicted 322
3 SASI_Mm01_00039427 predicted 331
4 SASI_Mm01_00039428 predicted 563
5 SASI_Mm01_00039429 predicted 705
6 SASI_Mm01_00039430 predicted 260
7 SASI_Mm01_00039431 predicted 301
8 SASI_Mm01_00039432 predicted 437
9 SASI_Mm01_00039433 predicted 528
10 SASI_Mm01_00039434 predicted 646
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018992
VALIDATED
KCTD5 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018992.1-711s1c1
Sequence:CCGGCCCAGCGAGAAGGCCAAGATTCTCGAGAATCTTGGCCTTCTCGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018992.1-291s1c1
Sequence:CCGGCTGGACTCAGACAAGGATGAACTCGAGTTCATCCTTGTCTGAGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018992.1-621s1c1
Sequence:CCGGTCTTACAACTATGGGAACGAACTCGAGTTCGTTCCCATAGTTGTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018992.1-617s1c1
Sequence:CCGGCTCCTCTTACAACTATGGGAACTCGAGTTCCCATAGTTGTAAGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018992.3-713s21c1
Sequence:CCGGCCCAGCGAGAAGGCCAAGATTCTCGAGAATCTTGGCCTTCTCGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018992.3-1075s21c1
Sequence:CCGGTCGTGTGAAGGAAGCGTTCTTCTCGAGAAGAACGCTTCCTTCACACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018992.3-596s21c1
Sequence:CCGGTTCGAGCAGTTGGTCAGCATCCTCGAGGATGCTGACCAACTGCTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018992.3-774s21c1
Sequence:CCGGGACAGCTGAAGAAATGATTTACTCGAGTAAATCATTTCTTCAGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018992.3-256s21c1
Sequence:CCGGATCCTTCCTGTACCGCTTATGCTCGAGCATAAGCGGTACAGGAAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018992
VALIDATED
KCTD5 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018992.1-711s1c1
Sequence:CCGGCCCAGCGAGAAGGCCAAGATTCTCGAGAATCTTGGCCTTCTCGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018992.1-291s1c1
Sequence:CCGGCTGGACTCAGACAAGGATGAACTCGAGTTCATCCTTGTCTGAGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018992.1-621s1c1
Sequence:CCGGTCTTACAACTATGGGAACGAACTCGAGTTCGTTCCCATAGTTGTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018992.1-617s1c1
Sequence:CCGGCTCCTCTTACAACTATGGGAACTCGAGTTCCCATAGTTGTAAGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018992.3-713s21c1
Sequence:CCGGCCCAGCGAGAAGGCCAAGATTCTCGAGAATCTTGGCCTTCTCGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018992.3-1075s21c1
Sequence:CCGGTCGTGTGAAGGAAGCGTTCTTCTCGAGAAGAACGCTTCCTTCACACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018992.3-596s21c1
Sequence:CCGGTTCGAGCAGTTGGTCAGCATCCTCGAGGATGCTGACCAACTGCTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018992.3-774s21c1
Sequence:CCGGGACAGCTGAAGAAATGATTTACTCGAGTAAATCATTTCTTCAGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018992.3-256s21c1
Sequence:CCGGATCCTTCCTGTACCGCTTATGCTCGAGCATAAGCGGTACAGGAAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018992
VALIDATED
KCTD5 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018992.1-711s1c1
Sequence:CCGGCCCAGCGAGAAGGCCAAGATTCTCGAGAATCTTGGCCTTCTCGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018992.1-291s1c1
Sequence:CCGGCTGGACTCAGACAAGGATGAACTCGAGTTCATCCTTGTCTGAGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018992.1-621s1c1
Sequence:CCGGTCTTACAACTATGGGAACGAACTCGAGTTCGTTCCCATAGTTGTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018992.1-617s1c1
Sequence:CCGGCTCCTCTTACAACTATGGGAACTCGAGTTCCCATAGTTGTAAGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018992.3-713s21c1
Sequence:CCGGCCCAGCGAGAAGGCCAAGATTCTCGAGAATCTTGGCCTTCTCGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018992.3-1075s21c1
Sequence:CCGGTCGTGTGAAGGAAGCGTTCTTCTCGAGAAGAACGCTTCCTTCACACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018992.3-596s21c1
Sequence:CCGGTTCGAGCAGTTGGTCAGCATCCTCGAGGATGCTGACCAACTGCTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018992.3-774s21c1
Sequence:CCGGGACAGCTGAAGAAATGATTTACTCGAGTAAATCATTTCTTCAGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018992.3-256s21c1
Sequence:CCGGATCCTTCCTGTACCGCTTATGCTCGAGCATAAGCGGTACAGGAAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027008
VALIDATED
KCTD5 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027008.1-274s1c1
Sequence:CCGGGCCTATTTAATCGACAGAGATCTCGAGATCTCTGTCGATTAAATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027008.1-573s1c1
Sequence:CCGGCTCCTCTTACAACTATGGAAACTCGAGTTTCCATAGTTGTAAGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027008.1-207s1c1
Sequence:CCGGGAAGTCTTTCCTGTACCGCTTCTCGAGAAGCGGTACAGGAAAGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027008.1-318s1c1
Sequence:CCGGGAACTACTTGAGACATGGAAACTCGAGTTTCCATGTCTCAAGTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027008.1-667s1c1
Sequence:CCGGCCAAGCGAGAAAGCCAAGATTCTCGAGAATCTTGGCTTTCTCGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027008.1-207s21c1
Sequence:CCGGGAAGTCTTTCCTGTACCGCTTCTCGAGAAGCGGTACAGGAAAGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027008.1-667s21c1
Sequence:CCGGCCAAGCGAGAAAGCCAAGATTCTCGAGAATCTTGGCTTTCTCGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027008.1-573s21c1
Sequence:CCGGCTCCTCTTACAACTATGGAAACTCGAGTTTCCATAGTTGTAAGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027008.1-318s21c1
Sequence:CCGGGAACTACTTGAGACATGGAAACTCGAGTTTCCATGTCTCAAGTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027008
VALIDATED
KCTD5 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027008.1-274s1c1
Sequence:CCGGGCCTATTTAATCGACAGAGATCTCGAGATCTCTGTCGATTAAATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027008.1-573s1c1
Sequence:CCGGCTCCTCTTACAACTATGGAAACTCGAGTTTCCATAGTTGTAAGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027008.1-207s1c1
Sequence:CCGGGAAGTCTTTCCTGTACCGCTTCTCGAGAAGCGGTACAGGAAAGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027008.1-318s1c1
Sequence:CCGGGAACTACTTGAGACATGGAAACTCGAGTTTCCATGTCTCAAGTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027008.1-667s1c1
Sequence:CCGGCCAAGCGAGAAAGCCAAGATTCTCGAGAATCTTGGCTTTCTCGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027008.1-207s21c1
Sequence:CCGGGAAGTCTTTCCTGTACCGCTTCTCGAGAAGCGGTACAGGAAAGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027008.1-667s21c1
Sequence:CCGGCCAAGCGAGAAAGCCAAGATTCTCGAGAATCTTGGCTTTCTCGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027008.1-573s21c1
Sequence:CCGGCTCCTCTTACAACTATGGAAACTCGAGTTTCCATAGTTGTAAGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027008.1-318s21c1
Sequence:CCGGGAACTACTTGAGACATGGAAACTCGAGTTTCCATGTCTCAAGTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027008
VALIDATED
KCTD5 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027008.1-274s1c1
Sequence:CCGGGCCTATTTAATCGACAGAGATCTCGAGATCTCTGTCGATTAAATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027008.1-573s1c1
Sequence:CCGGCTCCTCTTACAACTATGGAAACTCGAGTTTCCATAGTTGTAAGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027008.1-207s1c1
Sequence:CCGGGAAGTCTTTCCTGTACCGCTTCTCGAGAAGCGGTACAGGAAAGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027008.1-318s1c1
Sequence:CCGGGAACTACTTGAGACATGGAAACTCGAGTTTCCATGTCTCAAGTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027008.1-667s1c1
Sequence:CCGGCCAAGCGAGAAAGCCAAGATTCTCGAGAATCTTGGCTTTCTCGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027008.1-207s21c1
Sequence:CCGGGAAGTCTTTCCTGTACCGCTTCTCGAGAAGCGGTACAGGAAAGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027008.1-667s21c1
Sequence:CCGGCCAAGCGAGAAAGCCAAGATTCTCGAGAATCTTGGCTTTCTCGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027008.1-573s21c1
Sequence:CCGGCTCCTCTTACAACTATGGAAACTCGAGTTTCCATAGTTGTAAGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027008.1-318s21c1
Sequence:CCGGGAACTACTTGAGACATGGAAACTCGAGTTTCCATGTCTCAAGTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)