EMAIL THIS PAGE TO A FRIEND

KCTD6

potassium channel tetramerization domain containing 6

80 Gene Product Result for
Synonyms: KCASH3
UniProtKB ID: Q8NC69, B3KNI5, Q8NBS6, Q8TCA6
Gene ID:
Mouse(71393) potassium channel tetramerisation domain containing 6
Rat(305792) potassium channel tetramerization domain containing 6
domestic guinea pig(100733757) potassium channel tetramerization domain containing 6
naked mole-rat(101714955) potassium channel tetramerisation domain containing 6
sheep(101121715) potassium channel tetramerisation domain containing 6
chicken(416067) potassium channel tetramerisation domain containing 6
domestic cat(101100794) potassium channel tetramerisation domain containing 6
dog(100688570) potassium channel tetramerisation domain containing 6
cow(613649) potassium channel tetramerisation domain containing 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153331 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153331 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153331 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027782 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027782 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027782 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128214 Rosetta Predictions human pricing
NM_153331 Rosetta Predictions human pricing
NM_001107253 Rosetta Predictions rat pricing
NM_027782 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330886 predicted 652
2 SASI_Hs02_00330887 predicted 1232
3 SASI_Hs02_00330888 predicted 533
4 SASI_Hs02_00330889 predicted 1198
5 SASI_Hs02_00330890 predicted 410
6 SASI_Hs02_00330891 predicted 308
7 SASI_Hs02_00330892 predicted 321
8 SASI_Hs02_00330893 predicted 212
9 SASI_Hs02_00330894 predicted 545
10 SASI_Hs02_00330895 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132284 predicted 928
2 SASI_Hs01_00132285 predicted 1497
3 SASI_Hs01_00132286 predicted 805
4 SASI_Hs01_00132287 predicted 1466
5 SASI_Hs01_00132289 predicted 685
6 SASI_Hs01_00132290 predicted 583
7 SASI_Hs02_00367180 predicted 589
8 SASI_Hs01_00132291 predicted 427
9 SASI_Hs02_00367181 predicted 491
10 SASI_Hs01_00132292 predicted 818
11 SASI_Hs01_00132288 predicted 1519
12 SASI_Hs01_00132293 predicted 1450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107253 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227015 predicted 396
2 SASI_Rn02_00227016 predicted 550
3 SASI_Rn02_00227017 predicted 551
4 SASI_Rn02_00227018 predicted 552
5 SASI_Rn02_00227019 predicted 1141
6 SASI_Rn02_00227020 predicted 298
7 SASI_Rn02_00227021 predicted 216
8 SASI_Rn02_00227022 predicted 356
9 SASI_Rn02_00227023 predicted 361
10 SASI_Rn02_00227024 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027782 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090144 predicted 532
2 SASI_Mm01_00090145 predicted 717
3 SASI_Mm01_00090146 predicted 590
4 SASI_Mm01_00090147 predicted 1364
5 SASI_Mm01_00090148 predicted 1403
6 SASI_Mm01_00090149 predicted 777
7 SASI_Mm01_00090150 predicted 656
8 SASI_Mm01_00090151 predicted 490
9 SASI_Mm01_00090152 predicted 1350
10 SASI_Mm01_00090153 predicted 447
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153331
VALIDATED
KCTD6 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153331.3-1055s21c1
Sequence:CCGGGTGGAGCACAACTGGACTTTCCTCGAGGAAAGTCCAGTTGTGCTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153331.3-1511s21c1
Sequence:CCGGCATGTAGGGTGACCTAGTTTCCTCGAGGAAACTAGGTCACCCTACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153331.3-619s21c1
Sequence:CCGGATTGACCTTACCGTTGGATTTCTCGAGAAATCCAACGGTAAGGTCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153331.3-764s21c1
Sequence:CCGGAGTACTCGGAAGCTTTCTAAGCTCGAGCTTAGAAAGCTTCCGAGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153331.2-688s1c1
Sequence:CCGGGCCCTTGATTCAGTGTCTCAACTCGAGTTGAGACACTGAATCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153331.2-545s1c1
Sequence:CCGGCCTCAAGGCAATTACTTTATTCTCGAGAATAAAGTAATTGCCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153331.2-587s1c1
Sequence:CCGGCGATATGTCCTCAACTTCTTACTCGAGTAAGAAGTTGAGGACATATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153331.2-843s1c1
Sequence:CCGGCCTTACTAGAAGGCATCTCAACTCGAGTTGAGATGCCTTCTAGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153331
VALIDATED
KCTD6 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153331.3-1055s21c1
Sequence:CCGGGTGGAGCACAACTGGACTTTCCTCGAGGAAAGTCCAGTTGTGCTCCACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000427686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153331.3-1511s21c1
Sequence:CCGGCATGTAGGGTGACCTAGTTTCCTCGAGGAAACTAGGTCACCCTACATGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000417291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153331.3-619s21c1
Sequence:CCGGATTGACCTTACCGTTGGATTTCTCGAGAAATCCAACGGTAAGGTCAATTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000420641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153331.3-764s21c1
Sequence:CCGGAGTACTCGGAAGCTTTCTAAGCTCGAGCTTAGAAAGCTTCCGAGTACTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000044076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153331.2-688s1c1
Sequence:CCGGGCCCTTGATTCAGTGTCTCAACTCGAGTTGAGACACTGAATCAAGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000044074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153331.2-545s1c1
Sequence:CCGGCCTCAAGGCAATTACTTTATTCTCGAGAATAAAGTAATTGCCTTGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000044077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153331.2-587s1c1
Sequence:CCGGCGATATGTCCTCAACTTCTTACTCGAGTAAGAAGTTGAGGACATATCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000044073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153331.2-843s1c1
Sequence:CCGGCCTTACTAGAAGGCATCTCAACTCGAGTTGAGATGCCTTCTAGTAAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153331
VALIDATED
KCTD6 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153331.3-1055s21c1
Sequence:CCGGGTGGAGCACAACTGGACTTTCCTCGAGGAAAGTCCAGTTGTGCTCCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153331.3-1511s21c1
Sequence:CCGGCATGTAGGGTGACCTAGTTTCCTCGAGGAAACTAGGTCACCCTACATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153331.3-619s21c1
Sequence:CCGGATTGACCTTACCGTTGGATTTCTCGAGAAATCCAACGGTAAGGTCAATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153331.3-764s21c1
Sequence:CCGGAGTACTCGGAAGCTTTCTAAGCTCGAGCTTAGAAAGCTTCCGAGTACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153331.2-688s1c1
Sequence:CCGGGCCCTTGATTCAGTGTCTCAACTCGAGTTGAGACACTGAATCAAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153331.2-545s1c1
Sequence:CCGGCCTCAAGGCAATTACTTTATTCTCGAGAATAAAGTAATTGCCTTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153331.2-587s1c1
Sequence:CCGGCGATATGTCCTCAACTTCTTACTCGAGTAAGAAGTTGAGGACATATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153331.2-843s1c1
Sequence:CCGGCCTTACTAGAAGGCATCTCAACTCGAGTTGAGATGCCTTCTAGTAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027782
KCTD6 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027782.1-392s1c1
Sequence:CCGGCCTCAAGGCAATTACTTCATTCTCGAGAATGAAGTAATTGCCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027782.1-697s1c1
Sequence:CCGGCGAAGGCATCTCAAACTATTTCTCGAGAAATAGTTTGAGATGCCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027782.1-339s1c1
Sequence:CCGGCGGATTCTATGCTTGGAGCTACTCGAGTAGCTCCAAGCATAGAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027782.1-648s1c1
Sequence:CCGGCCGTCATCATCACCCAGTTAACTCGAGTTAACTGGGTGATGATGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027782.1-536s1c1
Sequence:CCGGCCCTTGATTCAGTGTCTCAATCTCGAGATTGAGACACTGAATCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027782
KCTD6 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027782.1-392s1c1
Sequence:CCGGCCTCAAGGCAATTACTTCATTCTCGAGAATGAAGTAATTGCCTTGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000068864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027782.1-697s1c1
Sequence:CCGGCGAAGGCATCTCAAACTATTTCTCGAGAAATAGTTTGAGATGCCTTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000068867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027782.1-339s1c1
Sequence:CCGGCGGATTCTATGCTTGGAGCTACTCGAGTAGCTCCAAGCATAGAATCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000068866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027782.1-648s1c1
Sequence:CCGGCCGTCATCATCACCCAGTTAACTCGAGTTAACTGGGTGATGATGACGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000068863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027782.1-536s1c1
Sequence:CCGGCCCTTGATTCAGTGTCTCAATCTCGAGATTGAGACACTGAATCAAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027782
KCTD6 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027782.1-392s1c1
Sequence:CCGGCCTCAAGGCAATTACTTCATTCTCGAGAATGAAGTAATTGCCTTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027782.1-697s1c1
Sequence:CCGGCGAAGGCATCTCAAACTATTTCTCGAGAAATAGTTTGAGATGCCTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027782.1-339s1c1
Sequence:CCGGCGGATTCTATGCTTGGAGCTACTCGAGTAGCTCCAAGCATAGAATCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027782.1-648s1c1
Sequence:CCGGCCGTCATCATCACCCAGTTAACTCGAGTTAACTGGGTGATGATGACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027782.1-536s1c1
Sequence:CCGGCCCTTGATTCAGTGTCTCAATCTCGAGATTGAGACACTGAATCAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)