EMAIL THIS PAGE TO A FRIEND

KCTD8

potassium channel tetramerization domain containing 8

106 Gene Product Result for
UniProtKB ID: Q6ZWB6, A2RU39
Gene ID:
Mouse(243043) potassium channel tetramerisation domain containing 8
Rat(364148) potassium channel tetramerization domain containing 8
domestic guinea pig(100719700) potassium channel tetramerization domain containing 8
naked mole-rat(101723954) potassium channel tetramerisation domain containing 8
sheep(101119822) potassium channel tetramerisation domain containing 8
Zebrafish(568933) potassium channel tetramerisation domain containing 8
cow(539881) potassium channel tetramerisation domain containing 8
domestic cat(101091620) potassium channel tetramerisation domain containing 8
dog(610705) potassium channel tetramerisation domain containing 8
chicken(770600) potassium channel tetramerisation domain containing 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198353 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175519 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175519 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175519 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198353 Rosetta Predictions human pricing
NM_001100172 Rosetta Predictions rat pricing
NM_175519 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019582 predicted 1101
2 SASI_Hs01_00019583 predicted 1686
3 SASI_Hs01_00019584 predicted 1579
4 SASI_Hs01_00019585 predicted 1580
5 SASI_Hs01_00019586 predicted 1707
6 SASI_Hs01_00019588 predicted 1301
7 SASI_Hs01_00019589 predicted 1769
8 SASI_Hs01_00019590 predicted 1682
9 SASI_Hs01_00019591 predicted 1424
10 SASI_Hs02_00371888 predicted 1971
11 SASI_Hs01_00019587 predicted 1787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100172 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209814 predicted 1630
2 SASI_Rn02_00209815 predicted 758
3 SASI_Rn02_00209816 predicted 1598
4 SASI_Rn02_00209817 predicted 1303
5 SASI_Rn02_00209818 predicted 1202
6 SASI_Rn02_00209819 predicted 1594
7 SASI_Rn02_00209820 predicted 522
8 SASI_Rn02_00209821 predicted 860
9 SASI_Rn02_00209822 predicted 1174
10 SASI_Rn02_00209823 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175519 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189809 predicted 1333
2 SASI_Mm01_00189810 predicted 1640
3 SASI_Mm01_00189811 predicted 1709
4 SASI_Mm01_00189812 predicted 1634
5 SASI_Mm01_00189813 predicted 568
6 SASI_Mm01_00189814 predicted 1703
7 SASI_Mm01_00189815 predicted 1347
8 SASI_Mm01_00189816 predicted 1650
9 SASI_Mm01_00189818 predicted 1168
10 SASI_Mm02_00346451 predicted 1313
11 SASI_Mm01_00189817 predicted 1642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198353
KCTD8 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198353.1-1545s1c1
Sequence:CCGGCGGGAAACAAATCTGTCCAAACTCGAGTTTGGACAGATTTGTTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198353.1-1434s1c1
Sequence:CCGGCCTAACACTTTAACATTGGATCTCGAGATCCAATGTTAAAGTGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198353.1-437s1c1
Sequence:CCGGCGGCCAGGTTTATGTGACCAACTCGAGTTGGTCACATAAACCTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198353.1-1683s1c1
Sequence:CCGGCTGTTGCAGAAGTATGGGTTACTCGAGTAACCCATACTTCTGCAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198353.1-1306s1c1
Sequence:CCGGTCACTGATAAAGGAAGTGAAACTCGAGTTTCACTTCCTTTATCAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198353
KCTD8 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198353.1-1545s1c1
Sequence:CCGGCGGGAAACAAATCTGTCCAAACTCGAGTTTGGACAGATTTGTTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198353.1-1434s1c1
Sequence:CCGGCCTAACACTTTAACATTGGATCTCGAGATCCAATGTTAAAGTGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198353.1-437s1c1
Sequence:CCGGCGGCCAGGTTTATGTGACCAACTCGAGTTGGTCACATAAACCTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198353.1-1683s1c1
Sequence:CCGGCTGTTGCAGAAGTATGGGTTACTCGAGTAACCCATACTTCTGCAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198353.1-1306s1c1
Sequence:CCGGTCACTGATAAAGGAAGTGAAACTCGAGTTTCACTTCCTTTATCAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198353
KCTD8 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198353.1-1545s1c1
Sequence:CCGGCGGGAAACAAATCTGTCCAAACTCGAGTTTGGACAGATTTGTTTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198353.1-1434s1c1
Sequence:CCGGCCTAACACTTTAACATTGGATCTCGAGATCCAATGTTAAAGTGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198353.1-437s1c1
Sequence:CCGGCGGCCAGGTTTATGTGACCAACTCGAGTTGGTCACATAAACCTGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198353.1-1683s1c1
Sequence:CCGGCTGTTGCAGAAGTATGGGTTACTCGAGTAACCCATACTTCTGCAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198353.1-1306s1c1
Sequence:CCGGTCACTGATAAAGGAAGTGAAACTCGAGTTTCACTTCCTTTATCAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175519
KCTD8 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175519.3-418s1c1
Sequence:CCGGCAGGTTTATGTGACCAAGCATCTCGAGATGCTTGGTCACATAAACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175519.3-1282s1c1
Sequence:CCGGCGCGACAAAGTCACAGACAAACTCGAGTTTGTCTGTGACTTTGTCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175519.3-1191s1c1
Sequence:CCGGCGACAAGATCTGGAGCAGTTACTCGAGTAACTGCTCCAGATCTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175519.3-1558s1c1
Sequence:CCGGGTCTGTGAGAAGCTAAGTGTACTCGAGTACACTTAGCTTCTCACAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175519.3-1416s1c1
Sequence:CCGGCCAGCCTAACACCTTAACCTTCTCGAGAAGGTTAAGGTGTTAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175519
KCTD8 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175519.3-418s1c1
Sequence:CCGGCAGGTTTATGTGACCAAGCATCTCGAGATGCTTGGTCACATAAACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175519.3-1282s1c1
Sequence:CCGGCGCGACAAAGTCACAGACAAACTCGAGTTTGTCTGTGACTTTGTCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175519.3-1191s1c1
Sequence:CCGGCGACAAGATCTGGAGCAGTTACTCGAGTAACTGCTCCAGATCTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175519.3-1558s1c1
Sequence:CCGGGTCTGTGAGAAGCTAAGTGTACTCGAGTACACTTAGCTTCTCACAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175519.3-1416s1c1
Sequence:CCGGCCAGCCTAACACCTTAACCTTCTCGAGAAGGTTAAGGTGTTAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175519
KCTD8 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175519.3-418s1c1
Sequence:CCGGCAGGTTTATGTGACCAAGCATCTCGAGATGCTTGGTCACATAAACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175519.3-1282s1c1
Sequence:CCGGCGCGACAAAGTCACAGACAAACTCGAGTTTGTCTGTGACTTTGTCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175519.3-1191s1c1
Sequence:CCGGCGACAAGATCTGGAGCAGTTACTCGAGTAACTGCTCCAGATCTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175519.3-1558s1c1
Sequence:CCGGGTCTGTGAGAAGCTAAGTGTACTCGAGTACACTTAGCTTCTCACAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175519.3-1416s1c1
Sequence:CCGGCCAGCCTAACACCTTAACCTTCTCGAGAAGGTTAAGGTGTTAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)