EMAIL THIS PAGE TO A FRIEND

KCTD9

potassium channel tetramerization domain containing 9

153 Gene Product Result for
Synonyms: BTBD27
UniProtKB ID: Q7L273, Q6NUM8, Q9NXV4
Gene ID:
Mouse(105440) potassium channel tetramerisation domain containing 9
Rat(364410) potassium channel tetramerization domain containing 9
Zebrafish(437011) potassium channel tetramerisation domain containing 9
cow(613717) potassium channel tetramerisation domain containing 9
domestic cat(101080529) potassium channel tetramerisation domain containing 9
dog(486109) potassium channel tetramerisation domain containing 9
chicken(419526) potassium channel tetramerisation domain containing 9
sheep(101111427) potassium channel tetramerisation domain containing 9
Domestic Rabbit(100352567) potassium channel tetramerisation domain containing 9
domestic guinea pig(100732066) potassium channel tetramerization domain containing 9
naked mole-rat(101706018) potassium channel tetramerisation domain containing 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017634 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017634 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017634 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134073 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134073 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134073 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017634 Rosetta Predictions human pricing
NM_001108871 Rosetta Predictions rat pricing
NM_001111028 Rosetta Predictions mouse pricing
NM_134073 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080438 predicted 880
2 SASI_Hs02_00350316 predicted 883
3 SASI_Hs02_00350317 predicted 966
4 SASI_Hs01_00080435 predicted 637
5 SASI_Hs02_00350318 predicted 575
6 SASI_Hs01_00080436 predicted 1058
7 SASI_Hs01_00080437 predicted 1107
8 SASI_Hs01_00080439 predicted 1071
9 SASI_Hs01_00080440 predicted 546
10 SASI_Hs01_00080442 predicted 492
11 SASI_Hs01_00080441 predicted 630
12 SASI_Hs01_00080443 predicted 635
13 SASI_Hs01_00080444 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242905 predicted 266
2 SASI_Rn02_00242906 predicted 1335
3 SASI_Rn02_00242907 predicted 988
4 SASI_Rn02_00242908 predicted 904
5 SASI_Rn02_00242909 predicted 969
6 SASI_Rn02_00242910 predicted 389
7 SASI_Rn02_00242911 predicted 982
8 SASI_Rn02_00242912 predicted 405
9 SASI_Rn02_00242913 predicted 977
10 SASI_Rn02_00242914 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306128 predicted 654
2 SASI_Mm02_00306129 predicted 1432
3 SASI_Mm02_00306130 predicted 1675
4 SASI_Mm02_00306131 predicted 1480
5 SASI_Mm02_00306132 predicted 407
6 SASI_Mm02_00306133 predicted 1651
7 SASI_Mm02_00306134 predicted 1516
8 SASI_Mm02_00306135 predicted 629
9 SASI_Mm02_00306136 predicted 1670
10 SASI_Mm02_00306137 predicted 1525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339265 predicted 656
2 SASI_Mm02_00339266 predicted 1286
3 SASI_Mm01_00085176 predicted 1528
4 SASI_Mm02_00339267 predicted 1330
5 SASI_Mm02_00339268 predicted 403
6 SASI_Mm02_00339269 predicted 1493
7 SASI_Mm01_00085179 predicted 1364
8 SASI_Mm02_00339270 predicted 621
9 SASI_Mm01_00085180 predicted 1524
10 SASI_Mm01_00085181 predicted 1370
11 SASI_Mm01_00085174 predicted 1185
12 SASI_Mm01_00085175 predicted 1756
13 SASI_Mm01_00085177 predicted 1101
14 SASI_Mm01_00085178 predicted 1083
15 SASI_Mm01_00085182 predicted 1092
16 SASI_Mm01_00085183 predicted 1714
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017634
VALIDATED
KCTD9 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017634.2-1065s1c1
Sequence:CCGGGCCAATTTAGAAGGTGCTAATCTCGAGATTAGCACCTTCTAAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_017634.2-468s1c1
Sequence:CCGGCGGAGCACTTTAGTGAATAAACTCGAGTTTATTCACTAAAGTGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017634.2-885s1c1
Sequence:CCGGGCCAATTTAAGCCGCTGTAATCTCGAGATTACAGCGGCTTAAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017634.2-761s1c1
Sequence:CCGGCCGAAAGGAATTTGTCCGATTCTCGAGAATCGGACAAATTCCTTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017634.2-250s1c1
Sequence:CCGGCCAGCAGTAAACTCGGCATAACTCGAGTTATGCCGAGTTTACTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017634.2-1260s21c1
Sequence:CCGGTCCAACGTGAAGGGAGCTATACTCGAGTATAGCTCCCTTCACGTTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017634.2-210s21c1
Sequence:CCGGGTTGCTGTATATGGAACTTTACTCGAGTAAAGTTCCATATACAGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_017634.2-731s21c1
Sequence:CCGGTCAACCACCGGAGGATCATTCCTCGAGGAATGATCCTCCGGTGGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017634.2-1609s21c1
Sequence:CCGGCAGGCATAGTATCTATTATATCTCGAGATATAATAGATACTATGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017634.2-885s21c1
Sequence:CCGGGCCAATTTAAGCCGCTGTAATCTCGAGATTACAGCGGCTTAAATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017634
VALIDATED
KCTD9 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017634.2-1065s1c1
Sequence:CCGGGCCAATTTAGAAGGTGCTAATCTCGAGATTAGCACCTTCTAAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_017634.2-468s1c1
Sequence:CCGGCGGAGCACTTTAGTGAATAAACTCGAGTTTATTCACTAAAGTGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017634.2-885s1c1
Sequence:CCGGGCCAATTTAAGCCGCTGTAATCTCGAGATTACAGCGGCTTAAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017634.2-761s1c1
Sequence:CCGGCCGAAAGGAATTTGTCCGATTCTCGAGAATCGGACAAATTCCTTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000044642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017634.2-250s1c1
Sequence:CCGGCCAGCAGTAAACTCGGCATAACTCGAGTTATGCCGAGTTTACTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017634.2-1260s21c1
Sequence:CCGGTCCAACGTGAAGGGAGCTATACTCGAGTATAGCTCCCTTCACGTTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017634.2-210s21c1
Sequence:CCGGGTTGCTGTATATGGAACTTTACTCGAGTAAAGTTCCATATACAGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_017634.2-731s21c1
Sequence:CCGGTCAACCACCGGAGGATCATTCCTCGAGGAATGATCCTCCGGTGGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017634.2-1609s21c1
Sequence:CCGGCAGGCATAGTATCTATTATATCTCGAGATATAATAGATACTATGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017634.2-885s21c1
Sequence:CCGGGCCAATTTAAGCCGCTGTAATCTCGAGATTACAGCGGCTTAAATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017634
VALIDATED
KCTD9 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017634.2-1065s1c1
Sequence:CCGGGCCAATTTAGAAGGTGCTAATCTCGAGATTAGCACCTTCTAAATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_017634.2-468s1c1
Sequence:CCGGCGGAGCACTTTAGTGAATAAACTCGAGTTTATTCACTAAAGTGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_017634.2-885s1c1
Sequence:CCGGGCCAATTTAAGCCGCTGTAATCTCGAGATTACAGCGGCTTAAATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017634.2-761s1c1
Sequence:CCGGCCGAAAGGAATTTGTCCGATTCTCGAGAATCGGACAAATTCCTTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000044642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017634.2-250s1c1
Sequence:CCGGCCAGCAGTAAACTCGGCATAACTCGAGTTATGCCGAGTTTACTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017634.2-1260s21c1
Sequence:CCGGTCCAACGTGAAGGGAGCTATACTCGAGTATAGCTCCCTTCACGTTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017634.2-210s21c1
Sequence:CCGGGTTGCTGTATATGGAACTTTACTCGAGTAAAGTTCCATATACAGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_017634.2-731s21c1
Sequence:CCGGTCAACCACCGGAGGATCATTCCTCGAGGAATGATCCTCCGGTGGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017634.2-1609s21c1
Sequence:CCGGCAGGCATAGTATCTATTATATCTCGAGATATAATAGATACTATGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017634.2-885s21c1
Sequence:CCGGGCCAATTTAAGCCGCTGTAATCTCGAGATTACAGCGGCTTAAATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134073
VALIDATED
KCTD9 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 9
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134073.1-1087s1c1
Sequence:CCGGGCCAACTTAGAGGGTGCTAATCTCGAGATTAGCACCCTCTAAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134073.1-952s1c1
Sequence:CCGGGCTAATCTTGAACGAGCTGATCTCGAGATCAGCTCGTTCAAGATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134073.1-1141s1c1
Sequence:CCGGACAGGGATTAACCTCAGAGTTCTCGAGAACTCTGAGGTTAATCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134073.1-1283s1c1
Sequence:CCGGCCAATGTGAAGGGTGCCATATCTCGAGATATGGCACCCTTCACATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134073.1-931s1c1
Sequence:CCGGGCACATGCAAATCTCTGCTGTCTCGAGACAGCAGAGATTTGCATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134073.2-1758s21c1
Sequence:CCGGCACATGAGGGTGGTTAGTTTACTCGAGTAAACTAACCACCCTCATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134073.2-996s21c1
Sequence:CCGGGCCAACTTAGAGGGTGCTAATCTCGAGATTAGCACCCTCTAAGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306184    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134073.2-1523s21c1
Sequence:CCGGCAGGAGTAGTAGCTATTATATCTCGAGATATAATAGCTACTACTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134073.2-655s21c1
Sequence:CCGGACCGAAGTCCTGAGTACTTTGCTCGAGCAAAGTACTCAGGACTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134073.2-1192s21c1
Sequence:CCGGCCAATGTGAAGGGTGCCATATCTCGAGATATGGCACCCTTCACATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134073.2-1119s21c1
Sequence:CCGGACTCTGGCAGGAACCGATTTACTCGAGTAAATCGGTTCCTGCCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134073
VALIDATED
KCTD9 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 9
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134073.1-1087s1c1
Sequence:CCGGGCCAACTTAGAGGGTGCTAATCTCGAGATTAGCACCCTCTAAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134073.1-952s1c1
Sequence:CCGGGCTAATCTTGAACGAGCTGATCTCGAGATCAGCTCGTTCAAGATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134073.1-1141s1c1
Sequence:CCGGACAGGGATTAACCTCAGAGTTCTCGAGAACTCTGAGGTTAATCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134073.1-1283s1c1
Sequence:CCGGCCAATGTGAAGGGTGCCATATCTCGAGATATGGCACCCTTCACATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000069067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134073.1-931s1c1
Sequence:CCGGGCACATGCAAATCTCTGCTGTCTCGAGACAGCAGAGATTTGCATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134073.2-1758s21c1
Sequence:CCGGCACATGAGGGTGGTTAGTTTACTCGAGTAAACTAACCACCCTCATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134073.2-996s21c1
Sequence:CCGGGCCAACTTAGAGGGTGCTAATCTCGAGATTAGCACCCTCTAAGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306184    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134073.2-1523s21c1
Sequence:CCGGCAGGAGTAGTAGCTATTATATCTCGAGATATAATAGCTACTACTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134073.2-655s21c1
Sequence:CCGGACCGAAGTCCTGAGTACTTTGCTCGAGCAAAGTACTCAGGACTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134073.2-1192s21c1
Sequence:CCGGCCAATGTGAAGGGTGCCATATCTCGAGATATGGCACCCTTCACATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134073.2-1119s21c1
Sequence:CCGGACTCTGGCAGGAACCGATTTACTCGAGTAAATCGGTTCCTGCCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134073
VALIDATED
KCTD9 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 9
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134073.1-1087s1c1
Sequence:CCGGGCCAACTTAGAGGGTGCTAATCTCGAGATTAGCACCCTCTAAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134073.1-952s1c1
Sequence:CCGGGCTAATCTTGAACGAGCTGATCTCGAGATCAGCTCGTTCAAGATTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134073.1-1141s1c1
Sequence:CCGGACAGGGATTAACCTCAGAGTTCTCGAGAACTCTGAGGTTAATCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134073.1-1283s1c1
Sequence:CCGGCCAATGTGAAGGGTGCCATATCTCGAGATATGGCACCCTTCACATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000069067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134073.1-931s1c1
Sequence:CCGGGCACATGCAAATCTCTGCTGTCTCGAGACAGCAGAGATTTGCATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134073.2-1758s21c1
Sequence:CCGGCACATGAGGGTGGTTAGTTTACTCGAGTAAACTAACCACCCTCATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134073.2-996s21c1
Sequence:CCGGGCCAACTTAGAGGGTGCTAATCTCGAGATTAGCACCCTCTAAGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306184    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134073.2-1523s21c1
Sequence:CCGGCAGGAGTAGTAGCTATTATATCTCGAGATATAATAGCTACTACTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134073.2-655s21c1
Sequence:CCGGACCGAAGTCCTGAGTACTTTGCTCGAGCAAAGTACTCAGGACTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134073.2-1192s21c1
Sequence:CCGGCCAATGTGAAGGGTGCCATATCTCGAGATATGGCACCCTTCACATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134073.2-1119s21c1
Sequence:CCGGACTCTGGCAGGAACCGATTTACTCGAGTAAATCGGTTCCTGCCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)