KCTD9

potassium channel tetramerization domain containing 9

153 Gene Product Result for

Synonyms: BTBD27

Species: Human KCTD9(54793), Mouse Kctd9(105440), Rat Kctd9(364410), Zebrafish kctd9(437011), cow KCTD9(613717), domestic cat KCTD9(101080529), dog KCTD9(486109), chicken KCTD9(419526), sheep KCTD9(101111427), Domestic Rabbit KCTD9(100352567), domestic guinea pig Kctd9(100732066), naked mole-rat Kctd9(101706018)

UniProtKB ID: Q7L273, Q6NUM8, Q9NXV4

Gene ID:

Human(54793)

Mouse(105440) potassium channel tetramerisation domain containing 9

Rat(364410) potassium channel tetramerization domain containing 9

Zebrafish(437011) potassium channel tetramerisation domain containing 9

cow(613717) potassium channel tetramerisation domain containing 9

domestic cat(101080529) potassium channel tetramerisation domain containing 9

dog(486109) potassium channel tetramerisation domain containing 9

chicken(419526) potassium channel tetramerisation domain containing 9

sheep(101111427) potassium channel tetramerisation domain containing 9

Domestic Rabbit(100352567) potassium channel tetramerisation domain containing 9

domestic guinea pig(100732066) potassium channel tetramerization domain containing 9

naked mole-rat(101706018) potassium channel tetramerisation domain containing 9

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB1105111	Anti-KCTD9 (121-135) antibody produced in rabbit IgG fraction of antiserum	human	western blot	pricing

SAB1105110	Anti-KCTD9 (66-78) antibody produced in rabbit IgG fraction of antiserum	human	western blot	pricing

SAB2105183	Anti-KCTD9 antibody produced in rabbit affinity isolated antibody	horse, rat, guinea pig, rabbit, human, mouse	western blot	pricing

SAB2106023	Anti-KCTD9 antibody produced in rabbit affinity isolated antibody	guinea pig, rabbit, human, horse	western blot	pricing

HPA042468	Anti-KCTD9 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunohistochemistry	pricing

HPA047902	Anti-KCTD9 antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody	human	immunofluorescence	pricing

WH0054793M1	Monoclonal Anti-KCTD9 antibody produced in mouse clone 1F3, purified immunoglobulin, buffered aqueous solution	human	ELISA, western blot	pricing

Zinc Finger Nucleases

Product #	Description	Add to Cart

CKOZFN11019	CompoZr^® Knockout ZFN Kit Human KCTD9 (NM_017634)	pricing

CKOZFN34224	CompoZr^® Knockout ZFN Kit Mouse Kctd9 (NM_134073.2)	pricing

CKOZFN55787	CompoZr^® Knockout ZFN Kit Rat Kctd9 (NM_001108871)	pricing

CKOZFND11019	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Human KCTD9 (NM_017634)	pricing

CKOZFND34224	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Mouse Kctd9 (NM_134073.2)	pricing

CKOZFND55787	CompoZr^® Knockout ZFN Kit, ZFN plasmid only Rat Kctd9 (NM_001108871)	pricing

Proteins

Product #	Description	Species	Add to Cart

APREST91111	PrEST Antigen KCTD9 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

APREST82945	PrEST Antigen KCTD9 Prestige Antigens^™ Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

QPREST29964	SILu^™PrEST KCTD9 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR10986	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, KCTD9	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_017634	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_017634	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_017634	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_134073	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_134073	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_134073	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU106981	MISSION^® esiRNA esiRNA human KCTD9 (esiRNA1)	human	pricing

EHU114751	MISSION^® esiRNA esiRNA human KCTD9L (esiRNA1)	human	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_017634	Rosetta Predictions	human	pricing
NM_001108871	Rosetta Predictions	rat	pricing
NM_001111028	Rosetta Predictions	mouse	pricing
NM_134073	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_017634	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00080438 predicted	880
2	SASI_Hs02_00350316 predicted	883
3	SASI_Hs02_00350317 predicted	966
4	SASI_Hs01_00080435 predicted	637
5	SASI_Hs02_00350318 predicted	575
6	SASI_Hs01_00080436 predicted	1058
7	SASI_Hs01_00080437 predicted	1107
8	SASI_Hs01_00080439 predicted	1071
9	SASI_Hs01_00080440 predicted	546
10	SASI_Hs01_00080442 predicted	492
11	SASI_Hs01_00080441 predicted	630
12	SASI_Hs01_00080443 predicted	635
13	SASI_Hs01_00080444 predicted	497

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001108871	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn02_00242905 predicted	266
2	SASI_Rn02_00242906 predicted	1335
3	SASI_Rn02_00242907 predicted	988
4	SASI_Rn02_00242908 predicted	904
5	SASI_Rn02_00242909 predicted	969
6	SASI_Rn02_00242910 predicted	389
7	SASI_Rn02_00242911 predicted	982
8	SASI_Rn02_00242912 predicted	405
9	SASI_Rn02_00242913 predicted	977
10	SASI_Rn02_00242914 predicted	1298

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001111028	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm02_00306128 predicted	654
2	SASI_Mm02_00306129 predicted	1432
3	SASI_Mm02_00306130 predicted	1675
4	SASI_Mm02_00306131 predicted	1480
5	SASI_Mm02_00306132 predicted	407
6	SASI_Mm02_00306133 predicted	1651
7	SASI_Mm02_00306134 predicted	1516
8	SASI_Mm02_00306135 predicted	629
9	SASI_Mm02_00306136 predicted	1670
10	SASI_Mm02_00306137 predicted	1525

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_134073	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm02_00339265 predicted	656
2	SASI_Mm02_00339266 predicted	1286
3	SASI_Mm01_00085176 predicted	1528
4	SASI_Mm02_00339267 predicted	1330
5	SASI_Mm02_00339268 predicted	403
6	SASI_Mm02_00339269 predicted	1493
7	SASI_Mm01_00085179 predicted	1364
8	SASI_Mm02_00339270 predicted	621
9	SASI_Mm01_00085180 predicted	1524
10	SASI_Mm01_00085181 predicted	1370
11	SASI_Mm01_00085174 predicted	1185
12	SASI_Mm01_00085175 predicted	1756
13	SASI_Mm01_00085177 predicted	1101
14	SASI_Mm01_00085178 predicted	1083
15	SASI_Mm01_00085182 predicted	1092
16	SASI_Mm01_00085183 predicted	1714

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_017634 VALIDATED	KCTD9 MISSION shRNA Bacterial Glycerol Stock potassium channel tetramerization domain containing 9	Human

10 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000044638
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: A549
	TRC Version: 1	Clone ID:NM_017634.2-1065s1c1
	Sequence:CCGGGCCAATTTAGAAGGTGCTAATCTCGAGATTAGCACCTTCTAAATTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000044641
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: A549
	TRC Version: 1	Clone ID:NM_017634.2-468s1c1
	Sequence:CCGGCGGAGCACTTTAGTGAATAAACTCGAGTTTATTCACTAAAGTGCTCCGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000044639
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.57	Cell Line: A549
	TRC Version: 1	Clone ID:NM_017634.2-885s1c1
	Sequence:CCGGGCCAATTTAAGCCGCTGTAATCTCGAGATTACAGCGGCTTAAATTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000044640
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_017634.2-761s1c1
	Sequence:CCGGCCGAAAGGAATTTGTCCGATTCTCGAGAATCGGACAAATTCCTTTCGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000044642
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_017634.2-250s1c1
	Sequence:CCGGCCAGCAGTAAACTCGGCATAACTCGAGTTATGCCGAGTTTACTGCTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232563
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: A549
	TRC Version: 2	Clone ID:NM_017634.2-1260s21c1
	Sequence:CCGGTCCAACGTGAAGGGAGCTATACTCGAGTATAGCTCCCTTCACGTTGGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232560
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_017634.2-210s21c1
	Sequence:CCGGGTTGCTGTATATGGAACTTTACTCGAGTAAAGTTCCATATACAGCAACTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232561
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.76	Cell Line: A549
	TRC Version: 2	Clone ID:NM_017634.2-731s21c1
	Sequence:CCGGTCAACCACCGGAGGATCATTCCTCGAGGAATGATCCTCCGGTGGTTGATTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232564
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_017634.2-1609s21c1
	Sequence:CCGGCAGGCATAGTATCTATTATATCTCGAGATATAATAGATACTATGCCTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232562
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: A549
	TRC Version: 2	Clone ID:NM_017634.2-885s21c1
	Sequence:CCGGGCCAATTTAAGCCGCTGTAATCTCGAGATTACAGCGGCTTAAATTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_017634 VALIDATED	KCTD9 MISSION shRNA shRNA Plasmid DNA potassium channel tetramerization domain containing 9	Human

10 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000044638
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: A549
	TRC Version: 1	Clone ID:NM_017634.2-1065s1c1
	Sequence:CCGGGCCAATTTAGAAGGTGCTAATCTCGAGATTAGCACCTTCTAAATTGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000044641
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: A549
	TRC Version: 1	Clone ID:NM_017634.2-468s1c1
	Sequence:CCGGCGGAGCACTTTAGTGAATAAACTCGAGTTTATTCACTAAAGTGCTCCGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000044639
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.57	Cell Line: A549
	TRC Version: 1	Clone ID:NM_017634.2-885s1c1
	Sequence:CCGGGCCAATTTAAGCCGCTGTAATCTCGAGATTACAGCGGCTTAAATTGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000044640
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_017634.2-761s1c1
	Sequence:CCGGCCGAAAGGAATTTGTCCGATTCTCGAGAATCGGACAAATTCCTTTCGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000044642
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_017634.2-250s1c1
	Sequence:CCGGCCAGCAGTAAACTCGGCATAACTCGAGTTATGCCGAGTTTACTGCTGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232563
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: A549
	TRC Version: 2	Clone ID:NM_017634.2-1260s21c1
	Sequence:CCGGTCCAACGTGAAGGGAGCTATACTCGAGTATAGCTCCCTTCACGTTGGATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232560
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_017634.2-210s21c1
	Sequence:CCGGGTTGCTGTATATGGAACTTTACTCGAGTAAAGTTCCATATACAGCAACTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232561
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.76	Cell Line: A549
	TRC Version: 2	Clone ID:NM_017634.2-731s21c1
	Sequence:CCGGTCAACCACCGGAGGATCATTCCTCGAGGAATGATCCTCCGGTGGTTGATTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232564
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_017634.2-1609s21c1
	Sequence:CCGGCAGGCATAGTATCTATTATATCTCGAGATATAATAGATACTATGCCTGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232562
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: A549
	TRC Version: 2	Clone ID:NM_017634.2-885s21c1
	Sequence:CCGGGCCAATTTAAGCCGCTGTAATCTCGAGATTACAGCGGCTTAAATTGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_017634 VALIDATED	KCTD9 MISSION shRNA Lentiviral Transduction Particles potassium channel tetramerization domain containing 9	Human

10 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000044638
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: A549
	TRC Version: 1	Clone ID:NM_017634.2-1065s1c1
	Sequence:CCGGGCCAATTTAGAAGGTGCTAATCTCGAGATTAGCACCTTCTAAATTGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000044641
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: A549
	TRC Version: 1	Clone ID:NM_017634.2-468s1c1
	Sequence:CCGGCGGAGCACTTTAGTGAATAAACTCGAGTTTATTCACTAAAGTGCTCCGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000044639
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.57	Cell Line: A549
	TRC Version: 1	Clone ID:NM_017634.2-885s1c1
	Sequence:CCGGGCCAATTTAAGCCGCTGTAATCTCGAGATTACAGCGGCTTAAATTGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000044640
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_017634.2-761s1c1
	Sequence:CCGGCCGAAAGGAATTTGTCCGATTCTCGAGAATCGGACAAATTCCTTTCGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000044642
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_017634.2-250s1c1
	Sequence:CCGGCCAGCAGTAAACTCGGCATAACTCGAGTTATGCCGAGTTTACTGCTGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232563
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: A549
	TRC Version: 2	Clone ID:NM_017634.2-1260s21c1
	Sequence:CCGGTCCAACGTGAAGGGAGCTATACTCGAGTATAGCTCCCTTCACGTTGGATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232560
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_017634.2-210s21c1
	Sequence:CCGGGTTGCTGTATATGGAACTTTACTCGAGTAAAGTTCCATATACAGCAACTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232561
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.76	Cell Line: A549
	TRC Version: 2	Clone ID:NM_017634.2-731s21c1
	Sequence:CCGGTCAACCACCGGAGGATCATTCCTCGAGGAATGATCCTCCGGTGGTTGATTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232564
Product Details	Region:3UTR
	TRC Version: 2	Clone ID:NM_017634.2-1609s21c1
	Sequence:CCGGCAGGCATAGTATCTATTATATCTCGAGATATAATAGATACTATGCCTGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000232562
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: A549
	TRC Version: 2	Clone ID:NM_017634.2-885s21c1
	Sequence:CCGGGCCAATTTAAGCCGCTGTAATCTCGAGATTACAGCGGCTTAAATTGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_134073 VALIDATED	KCTD9 MISSION shRNA Bacterial Glycerol Stock potassium channel tetramerization domain containing 9	Mouse

11 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000069063
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_134073.1-1087s1c1
	Sequence:CCGGGCCAACTTAGAGGGTGCTAATCTCGAGATTAGCACCCTCTAAGTTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000069064
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134073.1-952s1c1
	Sequence:CCGGGCTAATCTTGAACGAGCTGATCTCGAGATCAGCTCGTTCAAGATTAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000069065
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134073.1-1141s1c1
	Sequence:CCGGACAGGGATTAACCTCAGAGTTCTCGAGAACTCTGAGGTTAATCCCTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000069066
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_134073.1-1283s1c1
	Sequence:CCGGCCAATGTGAAGGGTGCCATATCTCGAGATATGGCACCCTTCACATTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000069067
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134073.1-931s1c1
	Sequence:CCGGGCACATGCAAATCTCTGCTGTCTCGAGACAGCAGAGATTTGCATGTGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000375395
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_134073.2-1758s21c1
	Sequence:CCGGCACATGAGGGTGGTTAGTTTACTCGAGTAAACTAACCACCCTCATGTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000326255
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_134073.2-996s21c1
	Sequence:CCGGGCCAACTTAGAGGGTGCTAATCTCGAGATTAGCACCCTCTAAGTTGGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306184
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.69	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_134073.2-1523s21c1
	Sequence:CCGGCAGGAGTAGTAGCTATTATATCTCGAGATATAATAGCTACTACTCCTGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000311480
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_134073.2-655s21c1
	Sequence:CCGGACCGAAGTCCTGAGTACTTTGCTCGAGCAAAGTACTCAGGACTTCGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000326312
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_134073.2-1192s21c1
	Sequence:CCGGCCAATGTGAAGGGTGCCATATCTCGAGATATGGCACCCTTCACATTGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000375396
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_134073.2-1119s21c1
	Sequence:CCGGACTCTGGCAGGAACCGATTTACTCGAGTAAATCGGTTCCTGCCAGAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_134073 VALIDATED	KCTD9 MISSION shRNA shRNA Plasmid DNA potassium channel tetramerization domain containing 9	Mouse

11 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000069063
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_134073.1-1087s1c1
	Sequence:CCGGGCCAACTTAGAGGGTGCTAATCTCGAGATTAGCACCCTCTAAGTTGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000069064
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134073.1-952s1c1
	Sequence:CCGGGCTAATCTTGAACGAGCTGATCTCGAGATCAGCTCGTTCAAGATTAGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000069065
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134073.1-1141s1c1
	Sequence:CCGGACAGGGATTAACCTCAGAGTTCTCGAGAACTCTGAGGTTAATCCCTGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000069066
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_134073.1-1283s1c1
	Sequence:CCGGCCAATGTGAAGGGTGCCATATCTCGAGATATGGCACCCTTCACATTGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000069067
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134073.1-931s1c1
	Sequence:CCGGGCACATGCAAATCTCTGCTGTCTCGAGACAGCAGAGATTTGCATGTGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000375395
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_134073.2-1758s21c1
	Sequence:CCGGCACATGAGGGTGGTTAGTTTACTCGAGTAAACTAACCACCCTCATGTGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000326255
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_134073.2-996s21c1
	Sequence:CCGGGCCAACTTAGAGGGTGCTAATCTCGAGATTAGCACCCTCTAAGTTGGCTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306184
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.69	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_134073.2-1523s21c1
	Sequence:CCGGCAGGAGTAGTAGCTATTATATCTCGAGATATAATAGCTACTACTCCTGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000311480
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_134073.2-655s21c1
	Sequence:CCGGACCGAAGTCCTGAGTACTTTGCTCGAGCAAAGTACTCAGGACTTCGGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000326312
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_134073.2-1192s21c1
	Sequence:CCGGCCAATGTGAAGGGTGCCATATCTCGAGATATGGCACCCTTCACATTGGTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000375396
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_134073.2-1119s21c1
	Sequence:CCGGACTCTGGCAGGAACCGATTTACTCGAGTAAATCGGTTCCTGCCAGAGTTTTTTG
	Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_134073 VALIDATED	KCTD9 MISSION shRNA Lentiviral Transduction Particles potassium channel tetramerization domain containing 9	Mouse

11 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000069063
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_134073.1-1087s1c1
	Sequence:CCGGGCCAACTTAGAGGGTGCTAATCTCGAGATTAGCACCCTCTAAGTTGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000069064
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134073.1-952s1c1
	Sequence:CCGGGCTAATCTTGAACGAGCTGATCTCGAGATCAGCTCGTTCAAGATTAGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000069065
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134073.1-1141s1c1
	Sequence:CCGGACAGGGATTAACCTCAGAGTTCTCGAGAACTCTGAGGTTAATCCCTGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000069066
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 1	Clone ID:NM_134073.1-1283s1c1
	Sequence:CCGGCCAATGTGAAGGGTGCCATATCTCGAGATATGGCACCCTTCACATTGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000069067
Product Details	Region:CDS
	TRC Version: 1	Clone ID:NM_134073.1-931s1c1
	Sequence:CCGGGCACATGCAAATCTCTGCTGTCTCGAGACAGCAGAGATTTGCATGTGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000375395
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_134073.2-1758s21c1
	Sequence:CCGGCACATGAGGGTGGTTAGTTTACTCGAGTAAACTAACCACCCTCATGTGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000326255
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.83	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_134073.2-996s21c1
	Sequence:CCGGGCCAACTTAGAGGGTGCTAATCTCGAGATTAGCACCCTCTAAGTTGGCTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000306184
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.69	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_134073.2-1523s21c1
	Sequence:CCGGCAGGAGTAGTAGCTATTATATCTCGAGATATAATAGCTACTACTCCTGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000311480
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.8	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_134073.2-655s21c1
	Sequence:CCGGACCGAAGTCCTGAGTACTTTGCTCGAGCAAAGTACTCAGGACTTCGGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000326312
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_134073.2-1192s21c1
	Sequence:CCGGCCAATGTGAAGGGTGCCATATCTCGAGATATGGCACCCTTCACATTGGTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000375396
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: Hepa 1-6
	TRC Version: 2	Clone ID:NM_134073.2-1119s21c1
	Sequence:CCGGACTCTGGCAGGAACCGATTTACTCGAGTAAATCGGTTCCTGCCAGAGTTTTTTG
	Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart